Incidental Mutation 'R7278:Elavl4'
ID571532
Institutional Source Beutler Lab
Gene Symbol Elavl4
Ensembl Gene ENSMUSG00000028546
Gene NameELAV like RNA binding protein 4
SynonymsHud
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.444) question?
Stock #R7278 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location110203722-110351909 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 110211425 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102722] [ENSMUST00000102723] [ENSMUST00000106597] [ENSMUST00000106598] [ENSMUST00000106600] [ENSMUST00000106601] [ENSMUST00000106603] [ENSMUST00000138972]
Predicted Effect probably null
Transcript: ENSMUST00000102722
SMART Domains Protein: ENSMUSP00000099783
Gene: ENSMUSG00000028546

DomainStartEndE-ValueType
low complexity region 18 33 N/A INTRINSIC
RRM 52 125 7.57e-24 SMART
RRM 138 213 1.35e-20 SMART
low complexity region 219 233 N/A INTRINSIC
RRM 289 362 2.37e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102723
SMART Domains Protein: ENSMUSP00000099784
Gene: ENSMUSG00000028546

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
RRM 47 120 7.57e-24 SMART
RRM 133 208 1.35e-20 SMART
low complexity region 214 228 N/A INTRINSIC
RRM 298 371 2.37e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106597
SMART Domains Protein: ENSMUSP00000102207
Gene: ENSMUSG00000028546

DomainStartEndE-ValueType
low complexity region 18 33 N/A INTRINSIC
RRM 52 125 7.57e-24 SMART
RRM 138 213 1.35e-20 SMART
low complexity region 219 233 N/A INTRINSIC
RRM 303 376 2.37e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106598
SMART Domains Protein: ENSMUSP00000102208
Gene: ENSMUSG00000028546

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
RRM 47 120 7.57e-24 SMART
RRM 133 208 1.35e-20 SMART
low complexity region 214 228 N/A INTRINSIC
RRM 284 357 2.37e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106600
SMART Domains Protein: ENSMUSP00000102210
Gene: ENSMUSG00000028546

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
RRM 64 137 7.57e-24 SMART
RRM 150 225 1.35e-20 SMART
low complexity region 231 245 N/A INTRINSIC
RRM 301 374 2.37e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106601
SMART Domains Protein: ENSMUSP00000102212
Gene: ENSMUSG00000028546

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
RRM 47 120 7.57e-24 SMART
RRM 133 208 1.35e-20 SMART
low complexity region 214 228 N/A INTRINSIC
RRM 284 357 2.37e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106603
SMART Domains Protein: ENSMUSP00000102214
Gene: ENSMUSG00000028546

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
RRM 50 123 7.57e-24 SMART
RRM 136 211 1.35e-20 SMART
low complexity region 217 231 N/A INTRINSIC
RRM 274 347 2.37e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138972
SMART Domains Protein: ENSMUSP00000123014
Gene: ENSMUSG00000028546

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
RRM 45 118 7.57e-24 SMART
Meta Mutation Damage Score 0.9484 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (78/79)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display increased neural progenitor self-renewal and impaired neuronal differentiation, partial penetrance of hind limb clasping, and impaired coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,065,476 L142P probably benign Het
Abca13 A T 11: 9,291,126 R996S possibly damaging Het
Abcb6 A G 1: 75,174,373 F558L possibly damaging Het
Acp7 T A 7: 28,630,882 D2V unknown Het
Acvr1c T C 2: 58,284,936 D280G probably damaging Het
Atp8a1 A G 5: 67,624,037 S1124P Het
B4galnt1 A T 10: 127,167,788 T207S probably benign Het
C2cd4d C A 3: 94,364,138 T237N probably benign Het
C8b T C 4: 104,780,627 C99R probably damaging Het
Ccnk C A 12: 108,193,705 Q149K possibly damaging Het
Chfr A G 5: 110,140,360 D47G probably benign Het
Chid1 A T 7: 141,529,488 probably null Het
Cmya5 T A 13: 93,095,700 E960V probably damaging Het
Col18a1 A G 10: 77,096,284 S112P unknown Het
Cps1 G A 1: 67,170,921 V637I probably damaging Het
Crispld1 A G 1: 17,752,878 T390A probably benign Het
Cyp2c54 A T 19: 40,070,253 L245* probably null Het
Ddr2 G T 1: 169,984,961 T654K probably damaging Het
Dnah10 T C 5: 124,791,791 probably null Het
Emilin1 T C 5: 30,920,660 V921A probably benign Het
Evpl T A 11: 116,223,113 E1250D probably damaging Het
Fam228a C T 12: 4,732,790 G101E probably benign Het
Fam92b T A 8: 120,168,603 T187S possibly damaging Het
Gemin4 T C 11: 76,212,106 T610A probably damaging Het
Glis1 T C 4: 107,435,683 M1T probably null Het
Gm14399 C T 2: 175,130,459 probably benign Het
Gorasp2 C T 2: 70,679,505 T170I probably damaging Het
Gpr37 A G 6: 25,669,342 V501A possibly damaging Het
Grik4 T A 9: 42,622,060 Q388L probably benign Het
Hspg2 T A 4: 137,551,125 D3035E probably damaging Het
Htr4 A T 18: 62,412,176 N11Y probably benign Het
Itgb2l A G 16: 96,429,043 S356P probably damaging Het
Klk1b22 A G 7: 44,114,749 N34D probably benign Het
Lmcd1 A G 6: 112,310,539 D62G possibly damaging Het
Lrp2 C T 2: 69,486,352 G2095E probably damaging Het
Macf1 T A 4: 123,440,743 E4407V possibly damaging Het
Mcm5 T C 8: 75,124,859 F631L probably benign Het
Mov10l1 A G 15: 88,993,868 S170G probably benign Het
Muc5b A T 7: 141,857,502 D1395V unknown Het
Muc6 G A 7: 141,640,575 T1395M probably benign Het
Myh15 A G 16: 49,091,105 D300G probably damaging Het
Nat6 T C 9: 107,583,299 L131P probably damaging Het
Ndst4 A G 3: 125,438,303 T174A probably benign Het
Nek5 T A 8: 22,090,484 N406I probably benign Het
Nr2c2 G A 6: 92,159,378 V400I probably damaging Het
Olfr364-ps1 G T 2: 37,147,009 V266L probably benign Het
Olfr365 T C 2: 37,202,080 Y280H probably damaging Het
Olfr449 G A 6: 42,834,396 probably null Het
Olfr554 T C 7: 102,640,983 S246P probably damaging Het
Olfr612 A T 7: 103,538,728 Y169N probably benign Het
Olfr787 T A 10: 129,462,751 I25N probably damaging Het
Parn T C 16: 13,626,063 probably null Het
Pfkl T C 10: 77,992,023 T468A probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Plce1 T C 19: 38,779,896 I2205T possibly damaging Het
Prss16 A T 13: 22,003,147 N442K probably damaging Het
Pus7 A G 5: 23,752,344 S370P probably damaging Het
Ripk3 G T 14: 55,787,284 Y210* probably null Het
Rps6ka2 C A 17: 7,271,635 F317L probably damaging Het
Slc13a3 G A 2: 165,445,528 R169W possibly damaging Het
Slc6a21 T A 7: 45,282,480 I256N possibly damaging Het
Slc6a9 G A 4: 117,868,106 R589Q probably benign Het
Slc8a2 T C 7: 16,141,152 S442P probably damaging Het
Snupn T A 9: 56,982,744 M283K probably damaging Het
Steap3 A T 1: 120,234,357 M395K probably damaging Het
Sv2b G A 7: 75,147,654 P331S probably damaging Het
Tlr1 A G 5: 64,926,772 V154A probably benign Het
Tmem131 A G 1: 36,796,301 S1580P probably damaging Het
Tmem51 TCCCC TCCC 4: 142,037,685 probably null Het
Trav14d-3-dv8 G A 14: 53,078,761 R26H probably benign Het
Trp53 C T 11: 69,591,255 L365F probably benign Het
Trp53bp1 A T 2: 121,199,035 I1838N probably damaging Het
Ugt1a5 A T 1: 88,166,886 K279* probably null Het
Unc80 A G 1: 66,552,209 E1141G possibly damaging Het
Vti1b T C 12: 79,166,379 D49G probably benign Het
Wnt10a A T 1: 74,793,482 H78L possibly damaging Het
Zfp869 G A 8: 69,706,478 H482Y probably damaging Het
Zfyve1 A G 12: 83,551,540 V638A probably damaging Het
Other mutations in Elavl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Elavl4 APN 4 110206612 missense probably benign 0.03
IGL01777:Elavl4 APN 4 110206661 critical splice acceptor site probably null
IGL02212:Elavl4 APN 4 110206412 missense probably damaging 1.00
IGL03053:Elavl4 APN 4 110251494 missense possibly damaging 0.89
R0386:Elavl4 UTSW 4 110206705 intron probably benign
R1141:Elavl4 UTSW 4 110251368 nonsense probably null
R1826:Elavl4 UTSW 4 110251292 missense probably damaging 1.00
R5155:Elavl4 UTSW 4 110292636 missense probably null 0.22
R5294:Elavl4 UTSW 4 110211430 missense possibly damaging 0.90
R5507:Elavl4 UTSW 4 110213206 missense probably benign 0.17
R5558:Elavl4 UTSW 4 110206603 missense probably benign 0.37
R5927:Elavl4 UTSW 4 110290243 unclassified probably benign
R5987:Elavl4 UTSW 4 110290644 missense probably benign 0.40
R6376:Elavl4 UTSW 4 110255454 start gained probably benign
R6504:Elavl4 UTSW 4 110255382 intron probably null
R6987:Elavl4 UTSW 4 110251405 missense possibly damaging 0.70
R7431:Elavl4 UTSW 4 110226633 missense probably damaging 1.00
R7717:Elavl4 UTSW 4 110206466 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTTTAATTCACAGTCACAGTGAC -3'
(R):5'- GCCATCAAAGGACTGAATGGC -3'

Sequencing Primer
(F):5'- CAGAGGGCTAGGAAGTGCATTTTG -3'
(R):5'- GGACTGAATGGCCAGAAGC -3'
Posted On2019-09-13