Incidental Mutation 'R7278:Slc6a9'
ID571533
Institutional Source Beutler Lab
Gene Symbol Slc6a9
Ensembl Gene ENSMUSG00000028542
Gene Namesolute carrier family 6 (neurotransmitter transporter, glycine), member 9
SynonymsGlyt1, Glyt-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7278 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location117834506-117875198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 117868106 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 589 (R589Q)
Ref Sequence ENSEMBL: ENSMUSP00000066102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030269] [ENSMUST00000063857] [ENSMUST00000084325] [ENSMUST00000106422] [ENSMUST00000131938] [ENSMUST00000132043] [ENSMUST00000149168] [ENSMUST00000163288] [ENSMUST00000164853] [ENSMUST00000166325] [ENSMUST00000167287] [ENSMUST00000167443] [ENSMUST00000169885] [ENSMUST00000169990] [ENSMUST00000171052]
Predicted Effect probably benign
Transcript: ENSMUST00000030269
AA Change: R589Q

PolyPhen 2 Score 0.308 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030269
Gene: ENSMUSG00000028542
AA Change: R589Q

DomainStartEndE-ValueType
Pfam:SNF 27 562 5.1e-234 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063857
AA Change: R589Q

PolyPhen 2 Score 0.308 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000066102
Gene: ENSMUSG00000028542
AA Change: R589Q

DomainStartEndE-ValueType
Pfam:SNF 27 562 5.1e-234 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084325
SMART Domains Protein: ENSMUSP00000081352
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 230 1.9e-47 PFAM
Pfam:Glyco_transf_7C 232 310 2.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106422
SMART Domains Protein: ENSMUSP00000102030
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
coiled coil region 133 158 N/A INTRINSIC
low complexity region 254 266 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131938
Predicted Effect probably benign
Transcript: ENSMUST00000132043
SMART Domains Protein: ENSMUSP00000122676
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
Pfam:SNF 32 321 1.4e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149168
SMART Domains Protein: ENSMUSP00000129359
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
low complexity region 91 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163288
AA Change: R593Q

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127289
Gene: ENSMUSG00000028542
AA Change: R593Q

DomainStartEndE-ValueType
Pfam:SNF 46 566 2.1e-212 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164853
SMART Domains Protein: ENSMUSP00000132114
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
coiled coil region 133 158 N/A INTRINSIC
low complexity region 254 266 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166325
SMART Domains Protein: ENSMUSP00000131493
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
coiled coil region 33 57 N/A INTRINSIC
low complexity region 61 90 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167287
SMART Domains Protein: ENSMUSP00000126161
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
coiled coil region 13 38 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167443
SMART Domains Protein: ENSMUSP00000128771
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 188 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169885
AA Change: R477Q

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000127093
Gene: ENSMUSG00000028542
AA Change: R477Q

DomainStartEndE-ValueType
Pfam:SNF 1 450 1.2e-182 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169990
SMART Domains Protein: ENSMUSP00000127203
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
Pfam:SNF 84 373 2.3e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171052
SMART Domains Protein: ENSMUSP00000129502
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
Pfam:CCDC24 21 201 3.9e-67 PFAM
low complexity region 282 294 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The amino acid glycine acts as an inhibitory neurotransmitter in the central nervous system. The protein encoded by this gene is one of two transporters that stop glycine signaling by removing it from the synaptic cleft. [provided by RefSeq, Jun 2016]
PHENOTYPE: Homozygous null mice die shortly after birth exhibiting breathing and movement deficiencies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,065,476 L142P probably benign Het
Abca13 A T 11: 9,291,126 R996S possibly damaging Het
Abcb6 A G 1: 75,174,373 F558L possibly damaging Het
Acp7 T A 7: 28,630,882 D2V unknown Het
Acvr1c T C 2: 58,284,936 D280G probably damaging Het
Atp8a1 A G 5: 67,624,037 S1124P Het
B4galnt1 A T 10: 127,167,788 T207S probably benign Het
C2cd4d C A 3: 94,364,138 T237N probably benign Het
C8b T C 4: 104,780,627 C99R probably damaging Het
Ccnk C A 12: 108,193,705 Q149K possibly damaging Het
Chfr A G 5: 110,140,360 D47G probably benign Het
Chid1 A T 7: 141,529,488 probably null Het
Cmya5 T A 13: 93,095,700 E960V probably damaging Het
Col18a1 A G 10: 77,096,284 S112P unknown Het
Cps1 G A 1: 67,170,921 V637I probably damaging Het
Crispld1 A G 1: 17,752,878 T390A probably benign Het
Cyp2c54 A T 19: 40,070,253 L245* probably null Het
Ddr2 G T 1: 169,984,961 T654K probably damaging Het
Dnah10 T C 5: 124,791,791 probably null Het
Elavl4 C T 4: 110,211,425 probably null Het
Emilin1 T C 5: 30,920,660 V921A probably benign Het
Evpl T A 11: 116,223,113 E1250D probably damaging Het
Fam228a C T 12: 4,732,790 G101E probably benign Het
Fam92b T A 8: 120,168,603 T187S possibly damaging Het
Gemin4 T C 11: 76,212,106 T610A probably damaging Het
Glis1 T C 4: 107,435,683 M1T probably null Het
Gm14399 C T 2: 175,130,459 probably benign Het
Gorasp2 C T 2: 70,679,505 T170I probably damaging Het
Gpr37 A G 6: 25,669,342 V501A possibly damaging Het
Grik4 T A 9: 42,622,060 Q388L probably benign Het
Hspg2 T A 4: 137,551,125 D3035E probably damaging Het
Htr4 A T 18: 62,412,176 N11Y probably benign Het
Itgb2l A G 16: 96,429,043 S356P probably damaging Het
Klk1b22 A G 7: 44,114,749 N34D probably benign Het
Lmcd1 A G 6: 112,310,539 D62G possibly damaging Het
Lrp2 C T 2: 69,486,352 G2095E probably damaging Het
Macf1 T A 4: 123,440,743 E4407V possibly damaging Het
Mcm5 T C 8: 75,124,859 F631L probably benign Het
Mov10l1 A G 15: 88,993,868 S170G probably benign Het
Muc5b A T 7: 141,857,502 D1395V unknown Het
Muc6 G A 7: 141,640,575 T1395M probably benign Het
Myh15 A G 16: 49,091,105 D300G probably damaging Het
Nat6 T C 9: 107,583,299 L131P probably damaging Het
Ndst4 A G 3: 125,438,303 T174A probably benign Het
Nek5 T A 8: 22,090,484 N406I probably benign Het
Nr2c2 G A 6: 92,159,378 V400I probably damaging Het
Olfr364-ps1 G T 2: 37,147,009 V266L probably benign Het
Olfr365 T C 2: 37,202,080 Y280H probably damaging Het
Olfr449 G A 6: 42,834,396 probably null Het
Olfr554 T C 7: 102,640,983 S246P probably damaging Het
Olfr612 A T 7: 103,538,728 Y169N probably benign Het
Olfr787 T A 10: 129,462,751 I25N probably damaging Het
Parn T C 16: 13,626,063 probably null Het
Pfkl T C 10: 77,992,023 T468A probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Plce1 T C 19: 38,779,896 I2205T possibly damaging Het
Prss16 A T 13: 22,003,147 N442K probably damaging Het
Pus7 A G 5: 23,752,344 S370P probably damaging Het
Ripk3 G T 14: 55,787,284 Y210* probably null Het
Rps6ka2 C A 17: 7,271,635 F317L probably damaging Het
Slc13a3 G A 2: 165,445,528 R169W possibly damaging Het
Slc6a21 T A 7: 45,282,480 I256N possibly damaging Het
Slc8a2 T C 7: 16,141,152 S442P probably damaging Het
Snupn T A 9: 56,982,744 M283K probably damaging Het
Steap3 A T 1: 120,234,357 M395K probably damaging Het
Sv2b G A 7: 75,147,654 P331S probably damaging Het
Tlr1 A G 5: 64,926,772 V154A probably benign Het
Tmem131 A G 1: 36,796,301 S1580P probably damaging Het
Tmem51 TCCCC TCCC 4: 142,037,685 probably null Het
Trav14d-3-dv8 G A 14: 53,078,761 R26H probably benign Het
Trp53 C T 11: 69,591,255 L365F probably benign Het
Trp53bp1 A T 2: 121,199,035 I1838N probably damaging Het
Ugt1a5 A T 1: 88,166,886 K279* probably null Het
Unc80 A G 1: 66,552,209 E1141G possibly damaging Het
Vti1b T C 12: 79,166,379 D49G probably benign Het
Wnt10a A T 1: 74,793,482 H78L possibly damaging Het
Zfp869 G A 8: 69,706,478 H482Y probably damaging Het
Zfyve1 A G 12: 83,551,540 V638A probably damaging Het
Other mutations in Slc6a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Slc6a9 APN 4 117864617 missense probably damaging 1.00
IGL01728:Slc6a9 APN 4 117864605 missense probably damaging 1.00
IGL02111:Slc6a9 APN 4 117864013 missense probably benign 0.19
R0051:Slc6a9 UTSW 4 117864859 missense probably damaging 1.00
R0051:Slc6a9 UTSW 4 117864859 missense probably damaging 1.00
R1170:Slc6a9 UTSW 4 117864806 missense possibly damaging 0.77
R2872:Slc6a9 UTSW 4 117849381 start codon destroyed probably null 0.02
R2872:Slc6a9 UTSW 4 117849381 start codon destroyed probably null 0.02
R3499:Slc6a9 UTSW 4 117856803 missense probably benign 0.01
R4744:Slc6a9 UTSW 4 117867895 missense probably benign 0.00
R4970:Slc6a9 UTSW 4 117856008 missense probably damaging 1.00
R5055:Slc6a9 UTSW 4 117868150 unclassified probably null
R5103:Slc6a9 UTSW 4 117868155 missense probably benign
R5726:Slc6a9 UTSW 4 117864013 missense probably damaging 1.00
R6836:Slc6a9 UTSW 4 117867886 missense possibly damaging 0.49
R7030:Slc6a9 UTSW 4 117857436 missense possibly damaging 0.94
R7061:Slc6a9 UTSW 4 117868064 missense probably benign 0.40
R7863:Slc6a9 UTSW 4 117864010 missense probably damaging 1.00
R7946:Slc6a9 UTSW 4 117864010 missense probably damaging 1.00
R8036:Slc6a9 UTSW 4 117867886 missense possibly damaging 0.49
Z1176:Slc6a9 UTSW 4 117857366 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTCTTCAGGTGAGGAGTGAAGATG -3'
(R):5'- TCAAGGTGACAGCAGCCATC -3'

Sequencing Primer
(F):5'- GATGGACTGAACGGGGAC -3'
(R):5'- TCCGTGGTGGGAGCAAG -3'
Posted On2019-09-13