Incidental Mutation 'R7278:Hspg2'
ID 571535
Institutional Source Beutler Lab
Gene Symbol Hspg2
Ensembl Gene ENSMUSG00000028763
Gene Name perlecan (heparan sulfate proteoglycan 2)
Synonyms Plc, Pcn, per
MMRRC Submission 045360-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7278 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 137468769-137570630 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 137551125 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 3035 (D3035E)
Ref Sequence ENSEMBL: ENSMUSP00000131316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030547] [ENSMUST00000171332]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000030547
AA Change: D3027E

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030547
Gene: ENSMUSG00000028763
AA Change: D3027E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 53 78 N/A INTRINSIC
SEA 80 194 4.94e-18 SMART
LDLa 198 236 4.51e-12 SMART
low complexity region 253 267 N/A INTRINSIC
LDLa 284 321 1.62e-13 SMART
LDLa 324 361 2.59e-12 SMART
LDLa 367 405 3.86e-11 SMART
IGc2 419 486 4.06e-13 SMART
LamB 590 717 7.45e-54 SMART
EGF_Lam 764 811 6.05e-14 SMART
EGF_Lam 814 869 3.82e-2 SMART
EGF_like 871 921 6.74e-1 SMART
low complexity region 934 939 N/A INTRINSIC
LamB 985 1112 2.87e-55 SMART
Pfam:Laminin_EGF 1113 1156 7.5e-5 PFAM
EGF_Lam 1159 1206 1.1e-11 SMART
EGF_Lam 1209 1263 2.46e-5 SMART
EGF_Lam 1275 1322 4.96e-10 SMART
LamB 1391 1516 5.3e-59 SMART
EGF_like 1516 1560 3.36e0 SMART
EGF_Lam 1563 1610 2.66e-10 SMART
EGF_Lam 1613 1668 3.73e-5 SMART
IGc2 1688 1752 1.76e-8 SMART
IGc2 1783 1846 5.97e-11 SMART
IGc2 1877 1939 8.57e-12 SMART
IGc2 1967 2031 1.82e-15 SMART
IGc2 2056 2117 4.81e-15 SMART
IGc2 2157 2216 1.37e-10 SMART
IGc2 2251 2312 5.88e-10 SMART
low complexity region 2333 2344 N/A INTRINSIC
IGc2 2347 2408 1.97e-11 SMART
IGc2 2441 2502 1.59e-15 SMART
low complexity region 2517 2528 N/A INTRINSIC
IGc2 2538 2599 3.08e-13 SMART
IGc2 2634 2695 9.25e-17 SMART
low complexity region 2704 2728 N/A INTRINSIC
IGc2 2731 2792 1.84e-11 SMART
IGc2 2828 2889 2.11e-11 SMART
IGc2 2926 2987 3.25e-12 SMART
IG 3017 3098 3.62e-10 SMART
IGc2 3114 3180 9.05e-11 SMART
IGc2 3212 3273 2.44e-16 SMART
IGc2 3299 3360 2.26e-11 SMART
IGc2 3400 3461 6.81e-6 SMART
IGc2 3489 3550 1.59e-15 SMART
IGc2 3575 3636 2.54e-14 SMART
LamG 3672 3813 3.41e-39 SMART
EGF 3832 3866 6.91e-9 SMART
EGF 3872 3907 4.46e-3 SMART
LamG 3934 4070 4.78e-43 SMART
EGF 4092 4126 1.17e-6 SMART
EGF 4131 4161 1.87e-5 SMART
LamG 4211 4348 1.33e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171332
AA Change: D3035E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131316
Gene: ENSMUSG00000028763
AA Change: D3035E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 53 78 N/A INTRINSIC
SEA 80 194 4.94e-18 SMART
LDLa 198 236 4.51e-12 SMART
low complexity region 253 267 N/A INTRINSIC
LDLa 284 321 1.62e-13 SMART
LDLa 324 361 2.59e-12 SMART
LDLa 367 405 3.86e-11 SMART
IGc2 419 486 4.06e-13 SMART
LamB 590 717 7.45e-54 SMART
EGF_Lam 764 811 6.05e-14 SMART
EGF_Lam 814 869 3.82e-2 SMART
EGF_like 871 921 6.74e-1 SMART
low complexity region 934 939 N/A INTRINSIC
LamB 985 1112 2.87e-55 SMART
Pfam:Laminin_EGF 1114 1156 7.9e-5 PFAM
EGF_Lam 1159 1206 1.1e-11 SMART
EGF_Lam 1209 1263 2.46e-5 SMART
EGF_Lam 1275 1322 4.96e-10 SMART
LamB 1391 1516 5.3e-59 SMART
EGF_like 1516 1560 3.36e0 SMART
EGF_Lam 1563 1610 2.66e-10 SMART
EGF_Lam 1613 1668 3.73e-5 SMART
IGc2 1688 1752 1.76e-8 SMART
IGc2 1783 1846 5.97e-11 SMART
IGc2 1877 1939 8.57e-12 SMART
IGc2 1967 2031 1.82e-15 SMART
IGc2 2062 2123 4.81e-15 SMART
IGc2 2163 2222 1.37e-10 SMART
IGc2 2257 2318 5.88e-10 SMART
low complexity region 2339 2350 N/A INTRINSIC
IGc2 2353 2414 1.97e-11 SMART
IGc2 2447 2508 1.59e-15 SMART
low complexity region 2523 2534 N/A INTRINSIC
IGc2 2544 2605 3.08e-13 SMART
IGc2 2640 2701 9.25e-17 SMART
low complexity region 2710 2734 N/A INTRINSIC
IGc2 2737 2798 1.84e-11 SMART
IGc2 2836 2897 2.11e-11 SMART
IGc2 2934 2995 3.25e-12 SMART
IG 3025 3106 3.62e-10 SMART
IGc2 3122 3188 9.05e-11 SMART
IGc2 3220 3281 2.44e-16 SMART
IGc2 3307 3368 2.26e-11 SMART
IGc2 3408 3469 6.81e-6 SMART
IGc2 3497 3558 1.59e-15 SMART
IGc2 3583 3644 2.54e-14 SMART
LamG 3680 3821 3.41e-39 SMART
EGF 3840 3874 6.91e-9 SMART
EGF 3880 3915 4.46e-3 SMART
LamG 3942 4078 4.78e-43 SMART
EGF 4100 4134 1.17e-6 SMART
EGF 4139 4169 1.87e-5 SMART
LamG 4219 4356 1.33e-41 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the perlecan protein, which consists of a core protein to which three long chains of glycosaminoglycans (heparan sulfate or chondroitin sulfate) are attached. The perlecan protein is a large multidomain proteoglycan that binds to and cross-links many extracellular matrix components and cell-surface molecules. It has been shown that this protein interacts with laminin, prolargin, collagen type IV, FGFBP1, FBLN2, FGF7 and transthyretin, etc., and it plays essential roles in multiple biological activities. Perlecan is a key component of the vascular extracellular matrix, where it helps to maintain the endothelial barrier function. It is a potent inhibitor of smooth muscle cell proliferation and is thus thought to help maintain vascular homeostasis. It can also promote growth factor (e.g., FGF2) activity and thus stimulate endothelial growth and re-generation. It is a major component of basement membranes, where it is involved in the stabilization of other molecules as well as being involved with glomerular permeability to macromolecules and cell adhesion. Mutations in this gene cause Schwartz-Jampel syndrome type 1, Silverman-Handmaker type of dyssegmental dysplasia, and tardive dyskinesia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous targeted null mutants die either at embryonic day 10.5 with cardiac outflow defects and/or brain exencephaly or at birth with skeletal dysplasia including micromelia and craniofacial defects. An exon 3 deletion mutant shows only a lens defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,065,476 (GRCm38) L142P probably benign Het
Abca13 A T 11: 9,291,126 (GRCm38) R996S possibly damaging Het
Abcb6 A G 1: 75,174,373 (GRCm38) F558L possibly damaging Het
Acp7 T A 7: 28,630,882 (GRCm38) D2V unknown Het
Acvr1c T C 2: 58,284,936 (GRCm38) D280G probably damaging Het
Atp8a1 A G 5: 67,624,037 (GRCm38) S1124P Het
B4galnt1 A T 10: 127,167,788 (GRCm38) T207S probably benign Het
C2cd4d C A 3: 94,364,138 (GRCm38) T237N probably benign Het
C8b T C 4: 104,780,627 (GRCm38) C99R probably damaging Het
Ccnk C A 12: 108,193,705 (GRCm38) Q149K possibly damaging Het
Chfr A G 5: 110,140,360 (GRCm38) D47G probably benign Het
Chid1 A T 7: 141,529,488 (GRCm38) probably null Het
Cmya5 T A 13: 93,095,700 (GRCm38) E960V probably damaging Het
Col18a1 A G 10: 77,096,284 (GRCm38) S112P unknown Het
Cps1 G A 1: 67,170,921 (GRCm38) V637I probably damaging Het
Crispld1 A G 1: 17,752,878 (GRCm38) T390A probably benign Het
Cyp2c54 A T 19: 40,070,253 (GRCm38) L245* probably null Het
Ddr2 G T 1: 169,984,961 (GRCm38) T654K probably damaging Het
Dnah10 T C 5: 124,791,791 (GRCm38) probably null Het
Elavl4 C T 4: 110,211,425 (GRCm38) probably null Het
Emilin1 T C 5: 30,920,660 (GRCm38) V921A probably benign Het
Evpl T A 11: 116,223,113 (GRCm38) E1250D probably damaging Het
Fam228a C T 12: 4,732,790 (GRCm38) G101E probably benign Het
Fam92b T A 8: 120,168,603 (GRCm38) T187S possibly damaging Het
Gemin4 T C 11: 76,212,106 (GRCm38) T610A probably damaging Het
Glis1 T C 4: 107,435,683 (GRCm38) M1T probably null Het
Gm14399 C T 2: 175,130,459 (GRCm38) probably benign Het
Gorasp2 C T 2: 70,679,505 (GRCm38) T170I probably damaging Het
Gpr37 A G 6: 25,669,342 (GRCm38) V501A possibly damaging Het
Grik4 T A 9: 42,622,060 (GRCm38) Q388L probably benign Het
Htr4 A T 18: 62,412,176 (GRCm38) N11Y probably benign Het
Itgb2l A G 16: 96,429,043 (GRCm38) S356P probably damaging Het
Klk1b22 A G 7: 44,114,749 (GRCm38) N34D probably benign Het
Lmcd1 A G 6: 112,310,539 (GRCm38) D62G possibly damaging Het
Lrp2 C T 2: 69,486,352 (GRCm38) G2095E probably damaging Het
Macf1 T A 4: 123,440,743 (GRCm38) E4407V possibly damaging Het
Mcm5 T C 8: 75,124,859 (GRCm38) F631L probably benign Het
Mov10l1 A G 15: 88,993,868 (GRCm38) S170G probably benign Het
Muc5b A T 7: 141,857,502 (GRCm38) D1395V unknown Het
Muc6 G A 7: 141,640,575 (GRCm38) T1395M probably benign Het
Myh15 A G 16: 49,091,105 (GRCm38) D300G probably damaging Het
Nat6 T C 9: 107,583,299 (GRCm38) L131P probably damaging Het
Ndst4 A G 3: 125,438,303 (GRCm38) T174A probably benign Het
Nek5 T A 8: 22,090,484 (GRCm38) N406I probably benign Het
Nr2c2 G A 6: 92,159,378 (GRCm38) V400I probably damaging Het
Olfr364-ps1 G T 2: 37,147,009 (GRCm38) V266L probably benign Het
Olfr365 T C 2: 37,202,080 (GRCm38) Y280H probably damaging Het
Olfr449 G A 6: 42,834,396 (GRCm38) probably null Het
Olfr554 T C 7: 102,640,983 (GRCm38) S246P probably damaging Het
Olfr612 A T 7: 103,538,728 (GRCm38) Y169N probably benign Het
Olfr787 T A 10: 129,462,751 (GRCm38) I25N probably damaging Het
Parn T C 16: 13,626,063 (GRCm38) probably null Het
Pfkl T C 10: 77,992,023 (GRCm38) T468A probably damaging Het
Pi16 C A 17: 29,319,234 (GRCm38) P7Q possibly damaging Het
Plce1 T C 19: 38,779,896 (GRCm38) I2205T possibly damaging Het
Prss16 A T 13: 22,003,147 (GRCm38) N442K probably damaging Het
Pus7 A G 5: 23,752,344 (GRCm38) S370P probably damaging Het
Ripk3 G T 14: 55,787,284 (GRCm38) Y210* probably null Het
Rps6ka2 C A 17: 7,271,635 (GRCm38) F317L probably damaging Het
Slc13a3 G A 2: 165,445,528 (GRCm38) R169W possibly damaging Het
Slc6a21 T A 7: 45,282,480 (GRCm38) I256N possibly damaging Het
Slc6a9 G A 4: 117,868,106 (GRCm38) R589Q probably benign Het
Slc8a2 T C 7: 16,141,152 (GRCm38) S442P probably damaging Het
Snupn T A 9: 56,982,744 (GRCm38) M283K probably damaging Het
Steap3 A T 1: 120,234,357 (GRCm38) M395K probably damaging Het
Sv2b G A 7: 75,147,654 (GRCm38) P331S probably damaging Het
Tlr1 A G 5: 64,926,772 (GRCm38) V154A probably benign Het
Tmem131 A G 1: 36,796,301 (GRCm38) S1580P probably damaging Het
Tmem51 TCCCC TCCC 4: 142,037,685 (GRCm38) probably null Het
Trav14d-3-dv8 G A 14: 53,078,761 (GRCm38) R26H probably benign Het
Trp53 C T 11: 69,591,255 (GRCm38) L365F probably benign Het
Trp53bp1 A T 2: 121,199,035 (GRCm38) I1838N probably damaging Het
Ugt1a5 A T 1: 88,166,886 (GRCm38) K279* probably null Het
Unc80 A G 1: 66,552,209 (GRCm38) E1141G possibly damaging Het
Vti1b T C 12: 79,166,379 (GRCm38) D49G probably benign Het
Wnt10a A T 1: 74,793,482 (GRCm38) H78L possibly damaging Het
Zfp869 G A 8: 69,706,478 (GRCm38) H482Y probably damaging Het
Zfyve1 A G 12: 83,551,540 (GRCm38) V638A probably damaging Het
Other mutations in Hspg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Hspg2 APN 4 137,528,820 (GRCm38) missense probably damaging 1.00
IGL00339:Hspg2 APN 4 137,539,195 (GRCm38) missense probably damaging 1.00
IGL00943:Hspg2 APN 4 137,562,201 (GRCm38) missense probably benign 0.15
IGL00970:Hspg2 APN 4 137,542,590 (GRCm38) missense probably benign 0.09
IGL01011:Hspg2 APN 4 137,559,335 (GRCm38) missense probably damaging 1.00
IGL01148:Hspg2 APN 4 137,546,658 (GRCm38) missense probably benign 0.11
IGL01333:Hspg2 APN 4 137,540,314 (GRCm38) missense probably damaging 1.00
IGL01367:Hspg2 APN 4 137,538,489 (GRCm38) missense probably damaging 1.00
IGL01455:Hspg2 APN 4 137,553,817 (GRCm38) missense probably damaging 1.00
IGL01540:Hspg2 APN 4 137,519,706 (GRCm38) missense probably damaging 1.00
IGL01578:Hspg2 APN 4 137,539,183 (GRCm38) missense probably damaging 1.00
IGL01603:Hspg2 APN 4 137,552,803 (GRCm38) missense probably damaging 1.00
IGL01632:Hspg2 APN 4 137,514,773 (GRCm38) missense probably damaging 1.00
IGL01658:Hspg2 APN 4 137,564,926 (GRCm38) missense probably damaging 1.00
IGL01760:Hspg2 APN 4 137,512,671 (GRCm38) missense possibly damaging 0.60
IGL01976:Hspg2 APN 4 137,561,926 (GRCm38) missense probably damaging 1.00
IGL02024:Hspg2 APN 4 137,540,073 (GRCm38) missense probably damaging 1.00
IGL02033:Hspg2 APN 4 137,552,254 (GRCm38) missense probably benign
IGL02051:Hspg2 APN 4 137,568,389 (GRCm38) unclassified probably benign
IGL02124:Hspg2 APN 4 137,518,814 (GRCm38) splice site probably null
IGL02128:Hspg2 APN 4 137,564,016 (GRCm38) missense probably damaging 1.00
IGL02177:Hspg2 APN 4 137,515,316 (GRCm38) missense probably damaging 1.00
IGL02230:Hspg2 APN 4 137,518,645 (GRCm38) missense probably damaging 1.00
IGL02266:Hspg2 APN 4 137,510,577 (GRCm38) missense probably damaging 1.00
IGL02313:Hspg2 APN 4 137,508,389 (GRCm38) missense probably benign 0.03
IGL02477:Hspg2 APN 4 137,544,512 (GRCm38) splice site probably benign
IGL02514:Hspg2 APN 4 137,569,576 (GRCm38) missense probably benign 0.09
IGL02613:Hspg2 APN 4 137,544,420 (GRCm38) missense probably damaging 1.00
IGL02625:Hspg2 APN 4 137,512,642 (GRCm38) missense probably damaging 1.00
IGL02646:Hspg2 APN 4 137,551,848 (GRCm38) missense possibly damaging 0.60
IGL02651:Hspg2 APN 4 137,557,445 (GRCm38) splice site probably benign
IGL02701:Hspg2 APN 4 137,557,174 (GRCm38) missense probably damaging 0.96
IGL02833:Hspg2 APN 4 137,555,130 (GRCm38) missense probably benign 0.00
IGL02985:Hspg2 APN 4 137,507,803 (GRCm38) missense probably damaging 1.00
IGL03040:Hspg2 APN 4 137,561,825 (GRCm38) critical splice donor site probably null
IGL03181:Hspg2 APN 4 137,515,937 (GRCm38) missense probably damaging 1.00
IGL03349:Hspg2 APN 4 137,560,522 (GRCm38) splice site probably benign
G1patch:Hspg2 UTSW 4 137,515,307 (GRCm38) missense probably damaging 1.00
PIT4305001:Hspg2 UTSW 4 137,550,373 (GRCm38) missense possibly damaging 0.55
R0006:Hspg2 UTSW 4 137,519,931 (GRCm38) missense probably damaging 1.00
R0036:Hspg2 UTSW 4 137,542,849 (GRCm38) missense probably damaging 1.00
R0109:Hspg2 UTSW 4 137,562,201 (GRCm38) missense probably benign 0.15
R0131:Hspg2 UTSW 4 137,551,887 (GRCm38) missense probably damaging 1.00
R0131:Hspg2 UTSW 4 137,551,887 (GRCm38) missense probably damaging 1.00
R0132:Hspg2 UTSW 4 137,551,887 (GRCm38) missense probably damaging 1.00
R0245:Hspg2 UTSW 4 137,514,722 (GRCm38) missense probably damaging 1.00
R0388:Hspg2 UTSW 4 137,511,158 (GRCm38) missense probably damaging 1.00
R0389:Hspg2 UTSW 4 137,515,423 (GRCm38) missense possibly damaging 0.53
R0468:Hspg2 UTSW 4 137,533,529 (GRCm38) missense probably damaging 1.00
R0480:Hspg2 UTSW 4 137,550,024 (GRCm38) missense probably damaging 1.00
R0546:Hspg2 UTSW 4 137,502,294 (GRCm38) missense probably benign
R0599:Hspg2 UTSW 4 137,512,401 (GRCm38) missense probably damaging 0.98
R0652:Hspg2 UTSW 4 137,514,722 (GRCm38) missense probably damaging 1.00
R0671:Hspg2 UTSW 4 137,553,280 (GRCm38) missense probably damaging 1.00
R0760:Hspg2 UTSW 4 137,512,349 (GRCm38) missense probably damaging 1.00
R0883:Hspg2 UTSW 4 137,541,440 (GRCm38) missense probably benign 0.00
R1403:Hspg2 UTSW 4 137,540,100 (GRCm38) missense possibly damaging 0.90
R1417:Hspg2 UTSW 4 137,517,636 (GRCm38) missense probably benign
R1497:Hspg2 UTSW 4 137,548,096 (GRCm38) missense probably damaging 0.98
R1509:Hspg2 UTSW 4 137,511,241 (GRCm38) splice site probably benign
R1625:Hspg2 UTSW 4 137,518,971 (GRCm38) missense probably benign 0.23
R1630:Hspg2 UTSW 4 137,518,435 (GRCm38) missense probably damaging 1.00
R1651:Hspg2 UTSW 4 137,533,437 (GRCm38) nonsense probably null
R1699:Hspg2 UTSW 4 137,548,012 (GRCm38) splice site probably null
R1703:Hspg2 UTSW 4 137,559,151 (GRCm38) missense probably damaging 1.00
R1761:Hspg2 UTSW 4 137,514,673 (GRCm38) missense possibly damaging 0.90
R1775:Hspg2 UTSW 4 137,520,156 (GRCm38) missense probably damaging 0.99
R1779:Hspg2 UTSW 4 137,518,509 (GRCm38) missense probably damaging 1.00
R1843:Hspg2 UTSW 4 137,545,567 (GRCm38) missense probably damaging 1.00
R1891:Hspg2 UTSW 4 137,565,490 (GRCm38) missense probably damaging 1.00
R1930:Hspg2 UTSW 4 137,540,230 (GRCm38) missense probably damaging 1.00
R1931:Hspg2 UTSW 4 137,540,230 (GRCm38) missense probably damaging 1.00
R1942:Hspg2 UTSW 4 137,542,552 (GRCm38) missense possibly damaging 0.67
R1959:Hspg2 UTSW 4 137,564,895 (GRCm38) missense probably damaging 1.00
R2042:Hspg2 UTSW 4 137,568,366 (GRCm38) missense probably damaging 1.00
R2062:Hspg2 UTSW 4 137,559,367 (GRCm38) missense possibly damaging 0.79
R2098:Hspg2 UTSW 4 137,520,109 (GRCm38) missense probably damaging 1.00
R2158:Hspg2 UTSW 4 137,517,604 (GRCm38) missense probably damaging 1.00
R2280:Hspg2 UTSW 4 137,522,043 (GRCm38) missense probably damaging 1.00
R2890:Hspg2 UTSW 4 137,549,574 (GRCm38) missense probably damaging 1.00
R2927:Hspg2 UTSW 4 137,518,940 (GRCm38) missense probably damaging 1.00
R3428:Hspg2 UTSW 4 137,555,290 (GRCm38) missense probably damaging 1.00
R3744:Hspg2 UTSW 4 137,565,504 (GRCm38) splice site probably benign
R3873:Hspg2 UTSW 4 137,539,349 (GRCm38) missense probably damaging 1.00
R3874:Hspg2 UTSW 4 137,539,349 (GRCm38) missense probably damaging 1.00
R3917:Hspg2 UTSW 4 137,559,314 (GRCm38) missense probably damaging 1.00
R3932:Hspg2 UTSW 4 137,515,568 (GRCm38) missense probably damaging 0.99
R3933:Hspg2 UTSW 4 137,515,568 (GRCm38) missense probably damaging 0.99
R4134:Hspg2 UTSW 4 137,556,657 (GRCm38) missense probably damaging 0.99
R4272:Hspg2 UTSW 4 137,518,940 (GRCm38) missense probably damaging 1.00
R4273:Hspg2 UTSW 4 137,518,940 (GRCm38) missense probably damaging 1.00
R4274:Hspg2 UTSW 4 137,518,940 (GRCm38) missense probably damaging 1.00
R4275:Hspg2 UTSW 4 137,518,940 (GRCm38) missense probably damaging 1.00
R4288:Hspg2 UTSW 4 137,518,940 (GRCm38) missense probably damaging 1.00
R4289:Hspg2 UTSW 4 137,518,940 (GRCm38) missense probably damaging 1.00
R4354:Hspg2 UTSW 4 137,468,911 (GRCm38) missense probably benign 0.17
R4355:Hspg2 UTSW 4 137,529,418 (GRCm38) missense probably damaging 0.98
R4400:Hspg2 UTSW 4 137,548,122 (GRCm38) missense probably benign 0.01
R4411:Hspg2 UTSW 4 137,562,224 (GRCm38) missense probably benign
R4421:Hspg2 UTSW 4 137,548,122 (GRCm38) missense probably benign 0.01
R4592:Hspg2 UTSW 4 137,518,940 (GRCm38) missense probably damaging 1.00
R4612:Hspg2 UTSW 4 137,539,575 (GRCm38) missense possibly damaging 0.80
R4612:Hspg2 UTSW 4 137,518,940 (GRCm38) missense probably damaging 1.00
R4619:Hspg2 UTSW 4 137,546,573 (GRCm38) missense probably damaging 1.00
R4658:Hspg2 UTSW 4 137,533,730 (GRCm38) missense probably damaging 1.00
R4667:Hspg2 UTSW 4 137,539,645 (GRCm38) missense possibly damaging 0.90
R4724:Hspg2 UTSW 4 137,522,127 (GRCm38) missense probably damaging 0.96
R4739:Hspg2 UTSW 4 137,570,073 (GRCm38) unclassified probably benign
R4793:Hspg2 UTSW 4 137,529,473 (GRCm38) missense possibly damaging 0.95
R4826:Hspg2 UTSW 4 137,565,395 (GRCm38) missense probably damaging 1.00
R4838:Hspg2 UTSW 4 137,541,666 (GRCm38) missense possibly damaging 0.53
R4896:Hspg2 UTSW 4 137,518,940 (GRCm38) missense probably damaging 1.00
R4926:Hspg2 UTSW 4 137,542,530 (GRCm38) missense probably damaging 1.00
R4939:Hspg2 UTSW 4 137,508,031 (GRCm38) missense probably damaging 1.00
R5032:Hspg2 UTSW 4 137,518,940 (GRCm38) missense probably damaging 1.00
R5033:Hspg2 UTSW 4 137,518,940 (GRCm38) missense probably damaging 1.00
R5071:Hspg2 UTSW 4 137,540,230 (GRCm38) missense probably damaging 1.00
R5072:Hspg2 UTSW 4 137,540,230 (GRCm38) missense probably damaging 1.00
R5114:Hspg2 UTSW 4 137,511,926 (GRCm38) missense probably damaging 1.00
R5177:Hspg2 UTSW 4 137,518,772 (GRCm38) missense probably damaging 1.00
R5223:Hspg2 UTSW 4 137,543,914 (GRCm38) missense probably damaging 1.00
R5433:Hspg2 UTSW 4 137,528,794 (GRCm38) splice site probably null
R5529:Hspg2 UTSW 4 137,551,828 (GRCm38) missense probably damaging 1.00
R5541:Hspg2 UTSW 4 137,542,825 (GRCm38) missense probably benign 0.17
R5541:Hspg2 UTSW 4 137,520,551 (GRCm38) missense probably damaging 1.00
R5546:Hspg2 UTSW 4 137,548,174 (GRCm38) critical splice donor site probably null
R5728:Hspg2 UTSW 4 137,542,766 (GRCm38) missense possibly damaging 0.95
R5764:Hspg2 UTSW 4 137,561,721 (GRCm38) missense probably damaging 1.00
R5920:Hspg2 UTSW 4 137,553,782 (GRCm38) missense probably damaging 1.00
R5934:Hspg2 UTSW 4 137,518,772 (GRCm38) missense probably damaging 1.00
R6074:Hspg2 UTSW 4 137,540,735 (GRCm38) missense probably benign
R6164:Hspg2 UTSW 4 137,514,655 (GRCm38) missense possibly damaging 0.89
R6175:Hspg2 UTSW 4 137,569,518 (GRCm38) missense probably damaging 1.00
R6217:Hspg2 UTSW 4 137,540,248 (GRCm38) missense probably damaging 0.99
R6262:Hspg2 UTSW 4 137,519,686 (GRCm38) missense probably damaging 1.00
R6299:Hspg2 UTSW 4 137,544,705 (GRCm38) missense probably damaging 1.00
R6333:Hspg2 UTSW 4 137,561,955 (GRCm38) missense probably damaging 1.00
R6371:Hspg2 UTSW 4 137,541,695 (GRCm38) missense probably damaging 1.00
R6430:Hspg2 UTSW 4 137,539,396 (GRCm38) missense probably damaging 1.00
R6498:Hspg2 UTSW 4 137,507,801 (GRCm38) missense possibly damaging 0.46
R6522:Hspg2 UTSW 4 137,555,275 (GRCm38) missense probably damaging 1.00
R6680:Hspg2 UTSW 4 137,565,737 (GRCm38) missense probably benign 0.18
R6724:Hspg2 UTSW 4 137,515,307 (GRCm38) missense probably damaging 1.00
R6725:Hspg2 UTSW 4 137,515,307 (GRCm38) missense probably damaging 1.00
R6762:Hspg2 UTSW 4 137,551,803 (GRCm38) missense possibly damaging 0.83
R6785:Hspg2 UTSW 4 137,508,398 (GRCm38) missense probably damaging 0.99
R6788:Hspg2 UTSW 4 137,515,307 (GRCm38) missense probably damaging 1.00
R6931:Hspg2 UTSW 4 137,540,720 (GRCm38) missense probably damaging 1.00
R6959:Hspg2 UTSW 4 137,519,289 (GRCm38) missense probably benign 0.45
R6968:Hspg2 UTSW 4 137,535,156 (GRCm38) missense probably damaging 1.00
R6988:Hspg2 UTSW 4 137,528,890 (GRCm38) missense probably damaging 1.00
R7021:Hspg2 UTSW 4 137,542,269 (GRCm38) missense possibly damaging 0.69
R7089:Hspg2 UTSW 4 137,544,366 (GRCm38) missense possibly damaging 0.51
R7107:Hspg2 UTSW 4 137,510,652 (GRCm38) missense probably damaging 1.00
R7141:Hspg2 UTSW 4 137,552,116 (GRCm38) missense probably damaging 1.00
R7161:Hspg2 UTSW 4 137,514,719 (GRCm38) missense probably damaging 1.00
R7189:Hspg2 UTSW 4 137,533,561 (GRCm38) critical splice donor site probably null
R7238:Hspg2 UTSW 4 137,508,393 (GRCm38) missense probably damaging 1.00
R7253:Hspg2 UTSW 4 137,519,946 (GRCm38) missense probably benign 0.15
R7287:Hspg2 UTSW 4 137,529,556 (GRCm38) missense probably benign 0.00
R7390:Hspg2 UTSW 4 137,539,179 (GRCm38) missense probably damaging 1.00
R7436:Hspg2 UTSW 4 137,515,664 (GRCm38) missense probably damaging 0.99
R7479:Hspg2 UTSW 4 137,539,403 (GRCm38) missense probably benign 0.17
R7516:Hspg2 UTSW 4 137,542,620 (GRCm38) missense possibly damaging 0.94
R7540:Hspg2 UTSW 4 137,541,440 (GRCm38) missense possibly damaging 0.51
R7603:Hspg2 UTSW 4 137,557,192 (GRCm38) missense possibly damaging 0.91
R7603:Hspg2 UTSW 4 137,548,368 (GRCm38) missense probably damaging 1.00
R7625:Hspg2 UTSW 4 137,564,938 (GRCm38) missense probably damaging 1.00
R7696:Hspg2 UTSW 4 137,511,966 (GRCm38) missense possibly damaging 0.78
R7767:Hspg2 UTSW 4 137,511,866 (GRCm38) missense probably damaging 1.00
R7815:Hspg2 UTSW 4 137,512,464 (GRCm38) missense probably damaging 1.00
R7825:Hspg2 UTSW 4 137,558,849 (GRCm38) missense probably damaging 1.00
R7863:Hspg2 UTSW 4 137,564,824 (GRCm38) missense probably benign 0.03
R7885:Hspg2 UTSW 4 137,516,837 (GRCm38) missense probably damaging 1.00
R7899:Hspg2 UTSW 4 137,548,116 (GRCm38) missense possibly damaging 0.72
R7937:Hspg2 UTSW 4 137,550,932 (GRCm38) missense probably benign 0.01
R7975:Hspg2 UTSW 4 137,555,221 (GRCm38) missense probably benign 0.26
R8078:Hspg2 UTSW 4 137,508,022 (GRCm38) missense probably damaging 1.00
R8285:Hspg2 UTSW 4 137,512,663 (GRCm38) missense probably benign 0.18
R8314:Hspg2 UTSW 4 137,539,675 (GRCm38) missense probably benign 0.12
R8322:Hspg2 UTSW 4 137,518,979 (GRCm38) missense possibly damaging 0.88
R8323:Hspg2 UTSW 4 137,518,979 (GRCm38) missense possibly damaging 0.88
R8324:Hspg2 UTSW 4 137,518,979 (GRCm38) missense possibly damaging 0.88
R8341:Hspg2 UTSW 4 137,518,979 (GRCm38) missense possibly damaging 0.88
R8383:Hspg2 UTSW 4 137,544,370 (GRCm38) missense possibly damaging 0.66
R8425:Hspg2 UTSW 4 137,550,867 (GRCm38) nonsense probably null
R8491:Hspg2 UTSW 4 137,553,719 (GRCm38) missense probably benign 0.00
R8525:Hspg2 UTSW 4 137,539,448 (GRCm38) missense probably damaging 0.98
R8978:Hspg2 UTSW 4 137,564,030 (GRCm38) missense probably benign 0.09
R9152:Hspg2 UTSW 4 137,522,565 (GRCm38) missense possibly damaging 0.89
R9166:Hspg2 UTSW 4 137,542,874 (GRCm38) missense probably damaging 1.00
R9175:Hspg2 UTSW 4 137,529,346 (GRCm38) missense probably damaging 0.98
R9210:Hspg2 UTSW 4 137,562,479 (GRCm38) missense probably benign 0.05
R9221:Hspg2 UTSW 4 137,560,415 (GRCm38) missense possibly damaging 0.79
R9325:Hspg2 UTSW 4 137,538,241 (GRCm38) missense probably damaging 1.00
R9339:Hspg2 UTSW 4 137,551,169 (GRCm38) missense probably benign
R9340:Hspg2 UTSW 4 137,569,516 (GRCm38) missense probably damaging 1.00
R9358:Hspg2 UTSW 4 137,517,598 (GRCm38) missense probably damaging 1.00
R9451:Hspg2 UTSW 4 137,511,069 (GRCm38) missense probably damaging 1.00
R9534:Hspg2 UTSW 4 137,540,761 (GRCm38) missense probably benign
R9656:Hspg2 UTSW 4 137,551,885 (GRCm38) missense probably benign
R9664:Hspg2 UTSW 4 137,539,576 (GRCm38) missense probably benign 0.03
R9695:Hspg2 UTSW 4 137,538,390 (GRCm38) missense probably damaging 1.00
R9741:Hspg2 UTSW 4 137,512,651 (GRCm38) missense probably damaging 1.00
V5622:Hspg2 UTSW 4 137,533,738 (GRCm38) missense probably damaging 0.99
V5622:Hspg2 UTSW 4 137,533,738 (GRCm38) missense probably damaging 0.99
X0028:Hspg2 UTSW 4 137,550,391 (GRCm38) missense probably benign
Z1177:Hspg2 UTSW 4 137,568,373 (GRCm38) missense possibly damaging 0.64
Z1177:Hspg2 UTSW 4 137,564,518 (GRCm38) missense probably damaging 0.99
Z1177:Hspg2 UTSW 4 137,550,467 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCTTCCTTCCGTGAGTG -3'
(R):5'- GCGTGGGACTTGATCAAAGATG -3'

Sequencing Primer
(F):5'- CGTGAGTGCGGGGTGTG -3'
(R):5'- CCTTGGAGTCTCCTGGGTC -3'
Posted On 2019-09-13