Mutagenetix > Incidental Mutation

Incidental Mutation 'R0646:Akap13'

57156

Institutional Source

Beutler Lab

Gene Symbol

Akap13

Ensembl Gene

ENSMUSG00000066406

Gene Name

A kinase (PRKA) anchor protein 13

Synonyms

AKAP-Lbc, 5730522G15Rik, 1700026G02Rik, PROTO-LBC, PROTO-LB, Ht31, 5830460E08Rik

MMRRC Submission

038831-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0646 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75455534-75754609 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 75747746 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 2575 (Q2575K)

Ref Sequence

ENSEMBL: ENSMUSP00000147237 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166315] [ENSMUST00000207750]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000147005
AA Change: Q2575K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000117686
Gene: ENSMUSG00000066406
AA Change: Q2575K

Domain	Start	End	E-Value	Type
low complexity region	174	184	N/A	INTRINSIC
internal_repeat_1	485	695	4.85e-5	PROSPERO
low complexity region	773	789	N/A	INTRINSIC
low complexity region	896	908	N/A	INTRINSIC
low complexity region	1021	1032	N/A	INTRINSIC
Pfam:RII_binding_1	1218	1235	4.3e-6	PFAM
low complexity region	1429	1444	N/A	INTRINSIC
low complexity region	1479	1501	N/A	INTRINSIC
low complexity region	1601	1612	N/A	INTRINSIC
low complexity region	1738	1768	N/A	INTRINSIC
C1	1773	1819	1.95e-4	SMART
low complexity region	1876	1887	N/A	INTRINSIC
RhoGEF	1979	2171	1.28e-61	SMART
PH	2213	2316	2.94e-11	SMART
coiled coil region	2326	2363	N/A	INTRINSIC
low complexity region	2411	2430	N/A	INTRINSIC
low complexity region	2462	2472	N/A	INTRINSIC
coiled coil region	2551	2664	N/A	INTRINSIC
low complexity region	2746	2752	N/A	INTRINSIC
low complexity region	2758	2771	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166315
AA Change: Q2557K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000129784
Gene: ENSMUSG00000066406
AA Change: Q2557K

Domain	Start	End	E-Value	Type
low complexity region	174	184	N/A	INTRINSIC
low complexity region	773	789	N/A	INTRINSIC
low complexity region	896	908	N/A	INTRINSIC
low complexity region	1021	1032	N/A	INTRINSIC
low complexity region	1433	1448	N/A	INTRINSIC
low complexity region	1483	1505	N/A	INTRINSIC
low complexity region	1583	1594	N/A	INTRINSIC
low complexity region	1720	1750	N/A	INTRINSIC
C1	1755	1801	1.95e-4	SMART
low complexity region	1858	1869	N/A	INTRINSIC
RhoGEF	1961	2153	1.28e-61	SMART
PH	2195	2298	2.94e-11	SMART
coiled coil region	2308	2345	N/A	INTRINSIC
low complexity region	2393	2412	N/A	INTRINSIC
low complexity region	2444	2454	N/A	INTRINSIC
coiled coil region	2533	2646	N/A	INTRINSIC
low complexity region	2728	2734	N/A	INTRINSIC
low complexity region	2740	2753	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000207750
AA Change: Q2575K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Meta Mutation Damage Score

0.1750

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

95% (123/130)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms containing c-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains. The DH domain is associated with guanine nucleotide exchange activation for the Rho/Rac family of small GTP binding proteins, resulting in the conversion of the inactive GTPase to the active form capable of transducing signals. The PH domain has multiple functions. Therefore, these isoforms function as scaffolding proteins to coordinate a Rho signaling pathway, function as protein kinase A-anchoring proteins and, in addition, enhance ligand-dependent activity of estrogen receptors alpha and beta. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, arrested heart development, and forebrain hypoplasia. Heterozygous mice exhibit small spleen, impaired lymphocyte response to osmotic stress, decreased response to glucocorticoid, osteoporosis and impared osteogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 125 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	C	T	11: 23,575,491	R716H	probably damaging	Het
4930432E11Rik	C	T	7: 29,561,285		noncoding transcript	Het
A430078G23Rik	T	C	8: 3,386,959	Y250H	probably damaging	Het
Abcb11	A	G	2: 69,285,283	I579T	probably damaging	Het
Abcc9	T	C	6: 142,682,104	N400S	probably benign	Het
Adarb2	T	C	13: 8,731,819	L577P	probably damaging	Het
Agt	A	C	8: 124,557,113	N422K	probably damaging	Het
Ahnak	A	T	19: 9,013,402	K4017*	probably null	Het
Aldh3a2	A	T	11: 61,253,715	I339K	probably damaging	Het
Alox15	G	T	11: 70,345,624	Y483*	probably null	Het
Ampd1	A	T	3: 103,099,597	I713F	probably damaging	Het
Amph	A	T	13: 19,113,116	E344V	possibly damaging	Het
Arid5b	A	G	10: 68,096,977	S1032P	probably damaging	Het
Armc8	C	A	9: 99,505,688	L393F	probably damaging	Het
Bpnt1	A	G	1: 185,345,426		probably null	Het
Cachd1	G	A	4: 100,988,221	R970H	probably damaging	Het
Cd207	T	C	6: 83,675,756	T131A	probably benign	Het
Cd83	G	A	13: 43,797,533	V54I	probably benign	Het
Cfap43	T	C	19: 47,763,676	K1086E	probably benign	Het
Cfap65	A	T	1: 74,902,169	V1837E	probably benign	Het
Clcnka	T	A	4: 141,396,606	H89L	probably benign	Het
Cnga4	T	C	7: 105,404,975	I50T	possibly damaging	Het
Cog5	A	G	12: 31,837,359		probably benign	Het
Col11a2	T	A	17: 34,059,348		probably null	Het
Col28a1	T	G	6: 8,175,291	I186L	possibly damaging	Het
Col4a2	T	A	8: 11,431,252	M808K	probably benign	Het
Copb2	A	G	9: 98,563,475		probably benign	Het
Dbnl	G	A	11: 5,795,441		probably benign	Het
Dbx2	T	C	15: 95,654,612	T51A	possibly damaging	Het
Dcp1a	A	T	14: 30,502,885	M123L	probably damaging	Het
Ddx42	T	A	11: 106,232,833	F217I	probably benign	Het
Dlc1	T	C	8: 36,858,051	T367A	probably benign	Het
Dmgdh	A	T	13: 93,752,355	T834S	probably benign	Het
Dnah8	T	C	17: 30,684,173	S929P	probably damaging	Het
Dnase1l2	C	A	17: 24,441,082	V271L	possibly damaging	Het
Dsc1	T	C	18: 20,096,057	Y392C	probably damaging	Het
Edn1	T	C	13: 42,305,242		probably benign	Het
Eps8l3	T	C	3: 107,884,810	L351P	probably damaging	Het
F12	G	A	13: 55,422,483		probably benign	Het
Fam47e	T	C	5: 92,578,458		probably benign	Het
Fcrl5	C	A	3: 87,442,013	Q32K	probably benign	Het
Fndc1	C	T	17: 7,741,673	V1637I	possibly damaging	Het
Foxg1	G	T	12: 49,384,567		probably benign	Het
Frrs1	A	T	3: 116,902,421	I530F	possibly damaging	Het
Galnt5	A	T	2: 57,999,085	K232N	probably benign	Het
Ggt5	G	A	10: 75,602,648	V68M	probably damaging	Het
Gm11639	G	A	11: 104,720,501	D390N	probably benign	Het
Gm13084	A	C	4: 143,812,585	S113A	possibly damaging	Het
Gm16519	T	C	17: 70,929,106	C17R	probably benign	Het
Gm17535	A	G	9: 3,035,804	Y224C	probably null	Het
Gm884	T	A	11: 103,613,160	K485*	probably null	Het
Gm9631	T	G	11: 121,945,629	D28A	probably damaging	Het
Gpx2	T	C	12: 76,795,313	I21M	probably benign	Het
H2-Q2	T	G	17: 35,345,685	D354E	probably damaging	Het
Icam2	A	T	11: 106,380,891	I71K	probably damaging	Het
Il12a	T	C	3: 68,697,890		probably benign	Het
Insm2	C	G	12: 55,600,440	A323G	probably benign	Het
Itga1	T	C	13: 114,968,299	T1064A	probably benign	Het
Itgad	T	A	7: 128,174,004	V11E	possibly damaging	Het
Kctd15	C	T	7: 34,644,881	S115N	probably damaging	Het
Klra5	A	G	6: 129,903,564	W124R	probably damaging	Het
Kng2	T	A	16: 22,987,736	D571V	probably benign	Het
Kpna6	A	T	4: 129,650,790	F380I	probably benign	Het
Lipo1	A	T	19: 33,784,769	Y109*	probably null	Het
Man2a2	T	C	7: 80,363,197	H540R	possibly damaging	Het
Map2k4	T	C	11: 65,712,275	E188G	probably damaging	Het
Mast4	T	C	13: 102,758,744		probably benign	Het
Mbtd1	A	G	11: 93,905,212	D25G	probably damaging	Het
Med13	T	A	11: 86,331,089	Q238L	possibly damaging	Het
Mmachc	A	G	4: 116,703,654	Y215H	probably damaging	Het
Mtor	T	A	4: 148,484,354	Y1110*	probably null	Het
Nek2	A	G	1: 191,822,219	N57D	probably damaging	Het
Nek7	ACCCC	ACCC	1: 138,515,693		probably null	Het
Neo1	G	T	9: 58,931,034	T489K	probably damaging	Het
Neu1	T	A	17: 34,934,760	Y387N	probably damaging	Het
Nfasc	A	T	1: 132,608,438	C586*	probably null	Het
Nle1	G	A	11: 82,904,845	L259F	probably damaging	Het
Nrde2	G	A	12: 100,143,846	Q309*	probably null	Het
Nufip2	C	T	11: 77,686,453	H76Y	probably benign	Het
Olfr1330	A	C	4: 118,893,490	T136P	probably damaging	Het
Olfr1383	A	T	11: 49,524,578	N285I	probably damaging	Het
Olfr466	A	T	13: 65,153,063	I280F	probably damaging	Het
Olfr584	T	C	7: 103,086,151	F206S	probably damaging	Het
Olfr670	A	T	7: 104,959,811	I307N	probably benign	Het
Olfr731	A	T	14: 50,238,639	I82N	probably damaging	Het
Pcdhb5	A	G	18: 37,321,622	T352A	probably benign	Het
Pcdhb7	A	T	18: 37,343,389	D526V	probably damaging	Het
Phkg1	A	T	5: 129,864,553		probably null	Het
Plg	C	T	17: 12,418,736	T744M	probably damaging	Het
Plxnd1	A	C	6: 115,958,699		probably benign	Het
Poglut1	A	T	16: 38,529,475	I312N	probably damaging	Het
Ppp1r16a	C	T	15: 76,690,799		probably benign	Het
Ppt1	A	G	4: 122,844,099	M77V	probably benign	Het
Pramel5	G	T	4: 144,271,620	T351N	probably damaging	Het
Psmb4	G	A	3: 94,884,964	R216C	probably benign	Het
Ptprd	T	C	4: 76,084,403	T699A	probably damaging	Het
Retreg3	A	T	11: 101,098,629		probably benign	Het
Scaper	G	A	9: 55,758,056	A389V	probably damaging	Het
Serinc5	G	A	13: 92,688,737	D225N	possibly damaging	Het
Slco1a1	T	G	6: 141,925,754		probably benign	Het
Snapc1	C	T	12: 73,975,032	R81C	probably damaging	Het
Sod3	A	T	5: 52,368,079	D40V	probably benign	Het
Sorcs3	C	A	19: 48,206,295	A39E	probably benign	Het
Spon1	A	T	7: 114,039,821	T761S	probably benign	Het
Syde2	A	G	3: 146,014,249		probably null	Het
Synm	T	A	7: 67,759,168	D154V	probably benign	Het
Synpo2	T	C	3: 123,114,449	E406G	probably damaging	Het
Tcea3	T	A	4: 136,248,071	L8*	probably null	Het
Tec	G	A	5: 72,823,497	L33F	probably damaging	Het
Tex15	T	A	8: 33,582,326	S2634T	possibly damaging	Het
Tg	T	A	15: 66,729,626	Y162N	probably damaging	Het
Tmem8b	G	A	4: 43,690,123	V853I	probably benign	Het
Togaram1	A	G	12: 65,021,466	K1748E	probably damaging	Het
Ttn	T	C	2: 76,898,478		probably benign	Het
Usp36	C	T	11: 118,273,021	D234N	probably damaging	Het
Usp40	G	A	1: 87,978,522	P664S	probably benign	Het
Vmn1r54	T	A	6: 90,269,653	L183H	probably benign	Het
Vmn1r58	T	G	7: 5,410,677	I185L	probably benign	Het
Wnt8a	A	T	18: 34,547,565	R328W	probably benign	Het
Yars	A	G	4: 129,213,939		probably benign	Het
Zbtb49	A	C	5: 38,200,674	M745R	probably damaging	Het
Zeb1	T	G	18: 5,759,027	F162V	probably damaging	Het
Zfp369	A	T	13: 65,297,548	H835L	probably damaging	Het
Zic5	A	G	14: 122,463,939	V460A	unknown	Het
Zp3	A	G	5: 135,984,356	N181D	possibly damaging	Het

Other mutations in Akap13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Akap13	APN	7	75725971	missense	probably damaging	0.99
IGL00332:Akap13	APN	7	75728919	missense	probably damaging	1.00
IGL00481:Akap13	APN	7	75723895	missense	probably damaging	1.00
IGL00590:Akap13	APN	7	75610669	missense	probably benign	0.01
IGL00655:Akap13	APN	7	75704398	missense	probably damaging	0.99
IGL00766:Akap13	APN	7	75704512	missense	probably damaging	0.96
IGL00818:Akap13	APN	7	75609727	missense	probably benign	0.00
IGL00826:Akap13	APN	7	75677447	missense	probably damaging	1.00
IGL01014:Akap13	APN	7	75750633	utr 3 prime	probably benign
IGL01090:Akap13	APN	7	75666531	missense	probably benign	0.44
IGL01155:Akap13	APN	7	75569936	missense	probably damaging	1.00
IGL01326:Akap13	APN	7	75725348	missense	probably benign	0.30
IGL01456:Akap13	APN	7	75602847	missense	probably damaging	0.98
IGL01460:Akap13	APN	7	75747846	missense	probably benign	0.29
IGL01568:Akap13	APN	7	75608522	nonsense	probably null	0.00
IGL01610:Akap13	APN	7	75720180	missense	possibly damaging	0.71
IGL01610:Akap13	APN	7	75747605	missense	probably damaging	1.00
IGL01615:Akap13	APN	7	75697393	missense	probably damaging	1.00
IGL01667:Akap13	APN	7	75570019	missense	probably damaging	1.00
IGL01705:Akap13	APN	7	75746767	missense	possibly damaging	0.86
IGL02070:Akap13	APN	7	75666545	missense	probably benign	0.27
IGL02269:Akap13	APN	7	75602911	missense	probably benign
IGL02421:Akap13	APN	7	75717806	missense	possibly damaging	0.66
IGL02870:Akap13	APN	7	75609188	missense	probably damaging	0.96
IGL02944:Akap13	APN	7	75608657	missense	probably benign
IGL03051:Akap13	APN	7	75610485	nonsense	probably null
IGL03160:Akap13	APN	7	75730417	missense	probably damaging	1.00
IGL03245:Akap13	APN	7	75609752	missense	probably damaging	0.99
R0254:Akap13	UTSW	7	75736604	splice site	probably benign
R0310:Akap13	UTSW	7	75614930	missense	probably damaging	0.99
R0373:Akap13	UTSW	7	75609929	missense	probably benign	0.00
R0373:Akap13	UTSW	7	75730500	missense	probably damaging	1.00
R0408:Akap13	UTSW	7	75746796	missense	probably damaging	1.00
R0631:Akap13	UTSW	7	75614996	missense	probably damaging	0.99
R0781:Akap13	UTSW	7	75611377	missense	possibly damaging	0.56
R0845:Akap13	UTSW	7	75725380	missense	probably damaging	1.00
R1004:Akap13	UTSW	7	75687286	missense	probably damaging	0.99
R1024:Akap13	UTSW	7	75677409	missense	probably damaging	1.00
R1110:Akap13	UTSW	7	75611377	missense	possibly damaging	0.56
R1346:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1349:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1372:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1387:Akap13	UTSW	7	75586193	missense	probably damaging	0.97
R1442:Akap13	UTSW	7	75735778	missense	probably damaging	0.99
R1466:Akap13	UTSW	7	75729049	missense	possibly damaging	0.79
R1466:Akap13	UTSW	7	75729049	missense	possibly damaging	0.79
R1584:Akap13	UTSW	7	75729049	missense	possibly damaging	0.79
R1696:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1738:Akap13	UTSW	7	75677194	missense	probably damaging	1.00
R1773:Akap13	UTSW	7	75683451	missense	possibly damaging	0.80
R1785:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R1786:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R1791:Akap13	UTSW	7	75611035	missense	probably benign	0.00
R1819:Akap13	UTSW	7	75608705	missense	probably benign	0.04
R1879:Akap13	UTSW	7	75610727	missense	probably benign	0.01
R1989:Akap13	UTSW	7	75704516	missense	probably benign	0.01
R2016:Akap13	UTSW	7	75704531	missense	probably damaging	0.99
R2092:Akap13	UTSW	7	75610570	missense	probably benign	0.05
R2126:Akap13	UTSW	7	75725304	missense	possibly damaging	0.95
R2131:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R2132:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R2133:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R2251:Akap13	UTSW	7	75739477	missense	possibly damaging	0.50
R3704:Akap13	UTSW	7	75666550	missense	probably damaging	1.00
R3713:Akap13	UTSW	7	75586181	missense	probably damaging	0.98
R3731:Akap13	UTSW	7	75611377	missense	probably benign	0.39
R3765:Akap13	UTSW	7	75608837	missense	probably benign	0.04
R3788:Akap13	UTSW	7	75702153	critical splice donor site	probably null
R3793:Akap13	UTSW	7	75610141	missense	probably benign	0.00
R3970:Akap13	UTSW	7	75569951	nonsense	probably null
R4205:Akap13	UTSW	7	75610919	missense	probably benign	0.05
R4257:Akap13	UTSW	7	75611285	missense	probably damaging	0.98
R4374:Akap13	UTSW	7	75608984	missense	probably damaging	0.96
R4448:Akap13	UTSW	7	75742760	missense	probably damaging	1.00
R4450:Akap13	UTSW	7	75742760	missense	probably damaging	1.00
R4457:Akap13	UTSW	7	75739465	missense	probably damaging	0.99
R4458:Akap13	UTSW	7	75739465	missense	probably damaging	0.99
R4466:Akap13	UTSW	7	75602773	splice site	probably null
R4632:Akap13	UTSW	7	75666553	missense	possibly damaging	0.91
R4667:Akap13	UTSW	7	75729094	missense	probably damaging	1.00
R4669:Akap13	UTSW	7	75729094	missense	probably damaging	1.00
R4671:Akap13	UTSW	7	75579564	nonsense	probably null
R4821:Akap13	UTSW	7	75677507	intron	probably benign
R4868:Akap13	UTSW	7	75743504	missense	probably damaging	1.00
R4894:Akap13	UTSW	7	75725320	missense	possibly damaging	0.76
R4943:Akap13	UTSW	7	75749240	missense	probably benign	0.22
R4962:Akap13	UTSW	7	75749430	missense	probably damaging	0.98
R4988:Akap13	UTSW	7	75730528	missense	probably damaging	1.00
R5119:Akap13	UTSW	7	75687252	missense	probably damaging	0.98
R5141:Akap13	UTSW	7	75609614	missense	probably benign	0.18
R5419:Akap13	UTSW	7	75610243	missense	probably benign	0.01
R5427:Akap13	UTSW	7	75728869	missense	possibly damaging	0.89
R5429:Akap13	UTSW	7	75602904	missense	possibly damaging	0.70
R5432:Akap13	UTSW	7	75602830	missense	probably damaging	1.00
R5458:Akap13	UTSW	7	75586301	missense	probably damaging	1.00
R5636:Akap13	UTSW	7	75704372	missense	probably damaging	0.96
R5643:Akap13	UTSW	7	75702154	critical splice donor site	probably null
R5898:Akap13	UTSW	7	75729146	missense	probably damaging	1.00
R5932:Akap13	UTSW	7	75610184	missense	probably damaging	1.00
R6135:Akap13	UTSW	7	75609908	missense	possibly damaging	0.94
R6137:Akap13	UTSW	7	75677416	missense	probably damaging	1.00
R6182:Akap13	UTSW	7	75586280	missense	probably benign	0.45
R6310:Akap13	UTSW	7	75749193	missense	probably damaging	0.99
R6346:Akap13	UTSW	7	75685254	missense	probably damaging	1.00
R6466:Akap13	UTSW	7	75727044	missense	probably benign	0.01
R6605:Akap13	UTSW	7	75579768	missense	probably damaging	0.98
R6617:Akap13	UTSW	7	75730363	missense	possibly damaging	0.95
R6621:Akap13	UTSW	7	75569981	missense	probably damaging	1.00
R6703:Akap13	UTSW	7	75602898	missense	probably damaging	1.00
R6750:Akap13	UTSW	7	75739458	missense	probably benign	0.03
R7069:Akap13	UTSW	7	75610262	missense	probably benign	0.29
R7116:Akap13	UTSW	7	75720195	missense	probably benign	0.00
R7158:Akap13	UTSW	7	75579594	missense	probably damaging	0.97
R7159:Akap13	UTSW	7	75730579	missense	possibly damaging	0.72
R7467:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7468:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7471:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7472:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7477:Akap13	UTSW	7	75749247	missense	probably benign
R7636:Akap13	UTSW	7	75609873	missense	probably benign	0.04
R7650:Akap13	UTSW	7	75643454	missense	probably benign	0.20
R7671:Akap13	UTSW	7	75569900	missense	probably damaging	1.00
R7681:Akap13	UTSW	7	75728796	missense	possibly damaging	0.91
R7752:Akap13	UTSW	7	75677258	missense	possibly damaging	0.74
R7784:Akap13	UTSW	7	75610328	missense	probably benign	0.00
R7816:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7817:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7834:Akap13	UTSW	7	75742642	missense	possibly damaging	0.85
R7880:Akap13	UTSW	7	75586216	missense	probably damaging	0.97
R7942:Akap13	UTSW	7	75611470	missense	possibly damaging	0.50
R8006:Akap13	UTSW	7	75579696	missense	probably damaging	1.00
R8009:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8011:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8012:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8013:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8016:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8089:Akap13	UTSW	7	75610592	missense	possibly damaging	0.94
R8138:Akap13	UTSW	7	75702231	splice site	probably null
R8174:Akap13	UTSW	7	75728869	missense	possibly damaging	0.89
R8298:Akap13	UTSW	7	75747804	missense	probably damaging	1.00
R8444:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8445:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8465:Akap13	UTSW	7	75727038	missense	probably benign	0.11
R8512:Akap13	UTSW	7	75611086	missense	probably damaging	0.99
R8523:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8793:Akap13	UTSW	7	75725328	missense	probably benign	0.35
R8907:Akap13	UTSW	7	75610696	missense	probably benign	0.08
R8907:Akap13	UTSW	7	75610708	missense	probably damaging	0.99
R8928:Akap13	UTSW	7	75609858	missense	probably benign	0.00
R8929:Akap13	UTSW	7	75609004	missense	probably benign	0.00
R8937:Akap13	UTSW	7	75534853	critical splice donor site	probably null
R8967:Akap13	UTSW	7	75729134	missense	possibly damaging	0.80
R8986:Akap13	UTSW	7	75609326	missense	probably benign
R9152:Akap13	UTSW	7	75611285	missense	probably damaging	0.98
R9153:Akap13	UTSW	7	75609481	missense	probably benign	0.00
R9160:Akap13	UTSW	7	75735778	missense	possibly damaging	0.88
R9192:Akap13	UTSW	7	75704501	missense	probably benign	0.06
R9319:Akap13	UTSW	7	75609088	missense	probably benign	0.01
R9513:Akap13	UTSW	7	75704527	missense	probably benign	0.01
R9515:Akap13	UTSW	7	75704527	missense	probably benign	0.01
R9516:Akap13	UTSW	7	75704527	missense	probably benign	0.01
R9523:Akap13	UTSW	7	75643445	missense
R9564:Akap13	UTSW	7	75609413	missense	probably benign
R9621:Akap13	UTSW	7	75736342	missense	probably benign	0.09
R9686:Akap13	UTSW	7	75586336	missense	probably damaging	1.00
Z1176:Akap13	UTSW	7	75730552	missense	probably damaging	0.99
Z1177:Akap13	UTSW	7	75615005	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- TGTCGTGCTACAACAAGACAGCTAC -3'
(R):5'- GCAAAGGTTCTGATCCATCTGCCTC -3'

Sequencing Primer
(F):5'- CAGCTACATTGAGGATCAGAAGC -3'
(R):5'- CTCTCTAGGTCACACTGGTAAG -3'

Posted On

2013-07-11