Mutagenetix > Incidental Mutations

Incidental Mutation 'R7278:B4galnt1'

571564

Institutional Source

Beutler Lab

Gene Symbol

B4galnt1

Ensembl Gene

ENSMUSG00000006731

Gene Name

beta-1,4-N-acetyl-galactosaminyl transferase 1

Synonyms

Ggm2, Gal-NAc-T, GalNAcT, beta1,4GalNAC-T, GalNAc-T, Ggm-2, GM2/GD2 synthase, 4933429D13Rik, Galgt1

MMRRC Submission

Accession Numbers

Genbank: NM_008080; MGI: 1342057

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7278 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

127165225-127172330 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 127167788 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 207 (T207S)

Ref Sequence

ENSEMBL: ENSMUSP00000006914 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006914] [ENSMUST00000095270] [ENSMUST00000217678] [ENSMUST00000222911]

Predicted Effect

probably benign
Transcript: ENSMUST00000006914
AA Change: T207S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000006914
Gene: ENSMUSG00000006731
AA Change: T207S

Domain	Start	End	E-Value	Type
transmembrane domain	7	24	N/A	INTRINSIC
low complexity region	191	202	N/A	INTRINSIC
Pfam:Glycos_transf_2	280	450	7e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000095270

SMART Domains

Protein: ENSMUSP00000092904
Gene: ENSMUSG00000040441

Domain	Start	End	E-Value	Type
low complexity region	51	78	N/A	INTRINSIC
low complexity region	82	97	N/A	INTRINSIC
Pfam:Sulfate_transp	105	497	5.5e-103	PFAM
low complexity region	512	522	N/A	INTRINSIC
Pfam:STAS	549	664	3.3e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000217678

Predicted Effect

probably benign
Transcript: ENSMUST00000222911

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (78/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GM2 and GD2 gangliosides are sialic acid-containing glycosphingolipids. GalNAc-T is the enzyme involved in the biosynthesis of G(M2) and G(D2) glycosphingolipids. GalNAc-T catalyzes the transfer of GalNAc into G(M3) and G(D3) by a beta-1,4 linkage, resulting in the synthesis of G(M2) and G(D2), respectively. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for one knock-out allele lack all complex gangliosides but show normal brain histology and gross behavior with only subtle defects in neural conduction velocities. Mice homozygous for another knock-out allele exhibit male infertility due to degeneration of the seminiferous tubules. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	C	3: 138,065,476	L142P	probably benign	Het
Abca13	A	T	11: 9,291,126	R996S	possibly damaging	Het
Abcb6	A	G	1: 75,174,373	F558L	possibly damaging	Het
Acp7	T	A	7: 28,630,882	D2V	unknown	Het
Acvr1c	T	C	2: 58,284,936	D280G	probably damaging	Het
Atp8a1	A	G	5: 67,624,037	S1124P		Het
C2cd4d	C	A	3: 94,364,138	T237N	probably benign	Het
C8b	T	C	4: 104,780,627	C99R	probably damaging	Het
Ccnk	C	A	12: 108,193,705	Q149K	possibly damaging	Het
Chfr	A	G	5: 110,140,360	D47G	probably benign	Het
Chid1	A	T	7: 141,529,488		probably null	Het
Cmya5	T	A	13: 93,095,700	E960V	probably damaging	Het
Col18a1	A	G	10: 77,096,284	S112P	unknown	Het
Cps1	G	A	1: 67,170,921	V637I	probably damaging	Het
Crispld1	A	G	1: 17,752,878	T390A	probably benign	Het
Cyp2c54	A	T	19: 40,070,253	L245*	probably null	Het
Ddr2	G	T	1: 169,984,961	T654K	probably damaging	Het
Dnah10	T	C	5: 124,791,791		probably null	Het
Elavl4	C	T	4: 110,211,425		probably null	Het
Emilin1	T	C	5: 30,920,660	V921A	probably benign	Het
Evpl	T	A	11: 116,223,113	E1250D	probably damaging	Het
Fam228a	C	T	12: 4,732,790	G101E	probably benign	Het
Fam92b	T	A	8: 120,168,603	T187S	possibly damaging	Het
Gemin4	T	C	11: 76,212,106	T610A	probably damaging	Het
Glis1	T	C	4: 107,435,683	M1T	probably null	Het
Gm14399	C	T	2: 175,130,459		probably benign	Het
Gorasp2	C	T	2: 70,679,505	T170I	probably damaging	Het
Gpr37	A	G	6: 25,669,342	V501A	possibly damaging	Het
Grik4	T	A	9: 42,622,060	Q388L	probably benign	Het
Hspg2	T	A	4: 137,551,125	D3035E	probably damaging	Het
Htr4	A	T	18: 62,412,176	N11Y	probably benign	Het
Itgb2l	A	G	16: 96,429,043	S356P	probably damaging	Het
Klk1b22	A	G	7: 44,114,749	N34D	probably benign	Het
Lmcd1	A	G	6: 112,310,539	D62G	possibly damaging	Het
Lrp2	C	T	2: 69,486,352	G2095E	probably damaging	Het
Macf1	T	A	4: 123,440,743	E4407V	possibly damaging	Het
Mcm5	T	C	8: 75,124,859	F631L	probably benign	Het
Mov10l1	A	G	15: 88,993,868	S170G	probably benign	Het
Muc5b	A	T	7: 141,857,502	D1395V	unknown	Het
Muc6	G	A	7: 141,640,575	T1395M	probably benign	Het
Myh15	A	G	16: 49,091,105	D300G	probably damaging	Het
Nat6	T	C	9: 107,583,299	L131P	probably damaging	Het
Ndst4	A	G	3: 125,438,303	T174A	probably benign	Het
Nek5	T	A	8: 22,090,484	N406I	probably benign	Het
Nr2c2	G	A	6: 92,159,378	V400I	probably damaging	Het
Olfr364-ps1	G	T	2: 37,147,009	V266L	probably benign	Het
Olfr365	T	C	2: 37,202,080	Y280H	probably damaging	Het
Olfr449	G	A	6: 42,834,396		probably null	Het
Olfr554	T	C	7: 102,640,983	S246P	probably damaging	Het
Olfr612	A	T	7: 103,538,728	Y169N	probably benign	Het
Olfr787	T	A	10: 129,462,751	I25N	probably damaging	Het
Parn	T	C	16: 13,626,063		probably null	Het
Pfkl	T	C	10: 77,992,023	T468A	probably damaging	Het
Pi16	C	A	17: 29,319,234	P7Q	possibly damaging	Het
Plce1	T	C	19: 38,779,896	I2205T	possibly damaging	Het
Prss16	A	T	13: 22,003,147	N442K	probably damaging	Het
Pus7	A	G	5: 23,752,344	S370P	probably damaging	Het
Ripk3	G	T	14: 55,787,284	Y210*	probably null	Het
Rps6ka2	C	A	17: 7,271,635	F317L	probably damaging	Het
Slc13a3	G	A	2: 165,445,528	R169W	possibly damaging	Het
Slc6a21	T	A	7: 45,282,480	I256N	possibly damaging	Het
Slc6a9	G	A	4: 117,868,106	R589Q	probably benign	Het
Slc8a2	T	C	7: 16,141,152	S442P	probably damaging	Het
Snupn	T	A	9: 56,982,744	M283K	probably damaging	Het
Steap3	A	T	1: 120,234,357	M395K	probably damaging	Het
Sv2b	G	A	7: 75,147,654	P331S	probably damaging	Het
Tlr1	A	G	5: 64,926,772	V154A	probably benign	Het
Tmem131	A	G	1: 36,796,301	S1580P	probably damaging	Het
Tmem51	TCCCC	TCCC	4: 142,037,685		probably null	Het
Trav14d-3-dv8	G	A	14: 53,078,761	R26H	probably benign	Het
Trp53	C	T	11: 69,591,255	L365F	probably benign	Het
Trp53bp1	A	T	2: 121,199,035	I1838N	probably damaging	Het
Ugt1a5	A	T	1: 88,166,886	K279*	probably null	Het
Unc80	A	G	1: 66,552,209	E1141G	possibly damaging	Het
Vti1b	T	C	12: 79,166,379	D49G	probably benign	Het
Wnt10a	A	T	1: 74,793,482	H78L	possibly damaging	Het
Zfp869	G	A	8: 69,706,478	H482Y	probably damaging	Het
Zfyve1	A	G	12: 83,551,540	V638A	probably damaging	Het

Other mutations in B4galnt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00858:B4galnt1	APN	10	127167764	missense	probably benign	0.01
IGL01087:B4galnt1	APN	10	127166191	missense	probably damaging	1.00
IGL01301:B4galnt1	APN	10	127169779	missense	possibly damaging	0.56
IGL01924:B4galnt1	APN	10	127166761	missense	probably benign	0.01
IGL02996:B4galnt1	APN	10	127167003	missense	probably damaging	1.00
Hypokalemic	UTSW	10	127171793	unclassified	probably null
ANU18:B4galnt1	UTSW	10	127169779	missense	possibly damaging	0.56
R0233:B4galnt1	UTSW	10	127170911	unclassified	probably benign
R4646:B4galnt1	UTSW	10	127167836	missense	probably damaging	0.99
R4702:B4galnt1	UTSW	10	127167525	missense	possibly damaging	0.90
R4703:B4galnt1	UTSW	10	127167525	missense	possibly damaging	0.90
R4705:B4galnt1	UTSW	10	127167525	missense	possibly damaging	0.90
R4708:B4galnt1	UTSW	10	127169815	missense	probably damaging	1.00
R5377:B4galnt1	UTSW	10	127171822	missense	possibly damaging	0.95
R6644:B4galnt1	UTSW	10	127171793	unclassified	probably null
R7006:B4galnt1	UTSW	10	127169831	missense	probably benign	0.00
R7396:B4galnt1	UTSW	10	127171616	missense	possibly damaging	0.89
R7886:B4galnt1	UTSW	10	127167054	missense	probably damaging	0.99
R7969:B4galnt1	UTSW	10	127167054	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTTGATGGGTTACAGAGCCC -3'
(R):5'- AACATTCATTGTGTGTCTAGGCTG -3'

Sequencing Primer
(F):5'- ATGGGTTACAGAGCCCCACTC -3'
(R):5'- ATTCATTGTGTGTCTAGGCTGTTCTG -3'

Posted On

2019-09-13