Mutagenetix > Incidental Mutation

Incidental Mutation 'R7278:Cmya5'

571575

Institutional Source

Beutler Lab

Gene Symbol

Cmya5

Ensembl Gene

ENSMUSG00000047419

Gene Name

cardiomyopathy associated 5

Synonyms

Myospryn, 2310076E21Rik, 2310076E16Rik

MMRRC Submission

045360-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.252) question?

Stock #

R7278 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

93040713-93144724 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 93095700 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 960 (E960V)

Ref Sequence

ENSEMBL: ENSMUSP00000050408 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062122]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000062122
AA Change: E960V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000050408
Gene: ENSMUSG00000047419
AA Change: E960V

Domain	Start	End	E-Value	Type
low complexity region	20	46	N/A	INTRINSIC
low complexity region	129	140	N/A	INTRINSIC
internal_repeat_1	448	535	5.09e-18	PROSPERO
internal_repeat_1	543	625	5.09e-18	PROSPERO
low complexity region	626	645	N/A	INTRINSIC
low complexity region	679	691	N/A	INTRINSIC
low complexity region	734	741	N/A	INTRINSIC
low complexity region	1001	1010	N/A	INTRINSIC
low complexity region	1166	1183	N/A	INTRINSIC
low complexity region	1259	1267	N/A	INTRINSIC
low complexity region	1440	1449	N/A	INTRINSIC
low complexity region	1876	1889	N/A	INTRINSIC
low complexity region	2632	2645	N/A	INTRINSIC
low complexity region	3048	3057	N/A	INTRINSIC
FN3	3312	3399	7.29e-4	SMART
FN3	3411	3492	1.3e0	SMART
Pfam:SPRY	3551	3668	6.7e-8	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (78/79)

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	C	3: 138,065,476	L142P	probably benign	Het
Abca13	A	T	11: 9,291,126	R996S	possibly damaging	Het
Abcb6	A	G	1: 75,174,373	F558L	possibly damaging	Het
Acp7	T	A	7: 28,630,882	D2V	unknown	Het
Acvr1c	T	C	2: 58,284,936	D280G	probably damaging	Het
Atp8a1	A	G	5: 67,624,037	S1124P		Het
B4galnt1	A	T	10: 127,167,788	T207S	probably benign	Het
C2cd4d	C	A	3: 94,364,138	T237N	probably benign	Het
C8b	T	C	4: 104,780,627	C99R	probably damaging	Het
Ccnk	C	A	12: 108,193,705	Q149K	possibly damaging	Het
Chfr	A	G	5: 110,140,360	D47G	probably benign	Het
Chid1	A	T	7: 141,529,488		probably null	Het
Col18a1	A	G	10: 77,096,284	S112P	unknown	Het
Cps1	G	A	1: 67,170,921	V637I	probably damaging	Het
Crispld1	A	G	1: 17,752,878	T390A	probably benign	Het
Cyp2c54	A	T	19: 40,070,253	L245*	probably null	Het
Ddr2	G	T	1: 169,984,961	T654K	probably damaging	Het
Dnah10	T	C	5: 124,791,791		probably null	Het
Elavl4	C	T	4: 110,211,425		probably null	Het
Emilin1	T	C	5: 30,920,660	V921A	probably benign	Het
Evpl	T	A	11: 116,223,113	E1250D	probably damaging	Het
Fam228a	C	T	12: 4,732,790	G101E	probably benign	Het
Fam92b	T	A	8: 120,168,603	T187S	possibly damaging	Het
Gemin4	T	C	11: 76,212,106	T610A	probably damaging	Het
Glis1	T	C	4: 107,435,683	M1T	probably null	Het
Gm14399	C	T	2: 175,130,459		probably benign	Het
Gorasp2	C	T	2: 70,679,505	T170I	probably damaging	Het
Gpr37	A	G	6: 25,669,342	V501A	possibly damaging	Het
Grik4	T	A	9: 42,622,060	Q388L	probably benign	Het
Hspg2	T	A	4: 137,551,125	D3035E	probably damaging	Het
Htr4	A	T	18: 62,412,176	N11Y	probably benign	Het
Itgb2l	A	G	16: 96,429,043	S356P	probably damaging	Het
Klk1b22	A	G	7: 44,114,749	N34D	probably benign	Het
Lmcd1	A	G	6: 112,310,539	D62G	possibly damaging	Het
Lrp2	C	T	2: 69,486,352	G2095E	probably damaging	Het
Macf1	T	A	4: 123,440,743	E4407V	possibly damaging	Het
Mcm5	T	C	8: 75,124,859	F631L	probably benign	Het
Mov10l1	A	G	15: 88,993,868	S170G	probably benign	Het
Muc5b	A	T	7: 141,857,502	D1395V	unknown	Het
Muc6	G	A	7: 141,640,575	T1395M	probably benign	Het
Myh15	A	G	16: 49,091,105	D300G	probably damaging	Het
Nat6	T	C	9: 107,583,299	L131P	probably damaging	Het
Ndst4	A	G	3: 125,438,303	T174A	probably benign	Het
Nek5	T	A	8: 22,090,484	N406I	probably benign	Het
Nr2c2	G	A	6: 92,159,378	V400I	probably damaging	Het
Olfr364-ps1	G	T	2: 37,147,009	V266L	probably benign	Het
Olfr365	T	C	2: 37,202,080	Y280H	probably damaging	Het
Olfr449	G	A	6: 42,834,396		probably null	Het
Olfr554	T	C	7: 102,640,983	S246P	probably damaging	Het
Olfr612	A	T	7: 103,538,728	Y169N	probably benign	Het
Olfr787	T	A	10: 129,462,751	I25N	probably damaging	Het
Parn	T	C	16: 13,626,063		probably null	Het
Pfkl	T	C	10: 77,992,023	T468A	probably damaging	Het
Pi16	C	A	17: 29,319,234	P7Q	possibly damaging	Het
Plce1	T	C	19: 38,779,896	I2205T	possibly damaging	Het
Prss16	A	T	13: 22,003,147	N442K	probably damaging	Het
Pus7	A	G	5: 23,752,344	S370P	probably damaging	Het
Ripk3	G	T	14: 55,787,284	Y210*	probably null	Het
Rps6ka2	C	A	17: 7,271,635	F317L	probably damaging	Het
Slc13a3	G	A	2: 165,445,528	R169W	possibly damaging	Het
Slc6a21	T	A	7: 45,282,480	I256N	possibly damaging	Het
Slc6a9	G	A	4: 117,868,106	R589Q	probably benign	Het
Slc8a2	T	C	7: 16,141,152	S442P	probably damaging	Het
Snupn	T	A	9: 56,982,744	M283K	probably damaging	Het
Steap3	A	T	1: 120,234,357	M395K	probably damaging	Het
Sv2b	G	A	7: 75,147,654	P331S	probably damaging	Het
Tlr1	A	G	5: 64,926,772	V154A	probably benign	Het
Tmem131	A	G	1: 36,796,301	S1580P	probably damaging	Het
Tmem51	TCCCC	TCCC	4: 142,037,685		probably null	Het
Trav14d-3-dv8	G	A	14: 53,078,761	R26H	probably benign	Het
Trp53	C	T	11: 69,591,255	L365F	probably benign	Het
Trp53bp1	A	T	2: 121,199,035	I1838N	probably damaging	Het
Ugt1a5	A	T	1: 88,166,886	K279*	probably null	Het
Unc80	A	G	1: 66,552,209	E1141G	possibly damaging	Het
Vti1b	T	C	12: 79,166,379	D49G	probably benign	Het
Wnt10a	A	T	1: 74,793,482	H78L	possibly damaging	Het
Zfp869	G	A	8: 69,706,478	H482Y	probably damaging	Het
Zfyve1	A	G	12: 83,551,540	V638A	probably damaging	Het

Other mutations in Cmya5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Cmya5	APN	13	93093120	missense	probably benign	0.13
IGL00516:Cmya5	APN	13	93098167	missense	possibly damaging	0.73
IGL00654:Cmya5	APN	13	93094161	missense	probably benign	0.00
IGL00948:Cmya5	APN	13	93091036	missense	probably benign
IGL00966:Cmya5	APN	13	93097906	missense	probably benign	0.33
IGL00988:Cmya5	APN	13	93097933	missense	possibly damaging	0.96
IGL01106:Cmya5	APN	13	93084612	missense	probably damaging	1.00
IGL01331:Cmya5	APN	13	93096946	missense	possibly damaging	0.53
IGL01392:Cmya5	APN	13	93089206	missense	probably damaging	0.99
IGL01508:Cmya5	APN	13	93094027	missense	probably benign
IGL01679:Cmya5	APN	13	93065320	missense	probably damaging	1.00
IGL01749:Cmya5	APN	13	93089299	missense	probably benign	0.00
IGL01861:Cmya5	APN	13	93089748	missense	probably damaging	1.00
IGL02021:Cmya5	APN	13	93094549	missense	probably benign	0.00
IGL02034:Cmya5	APN	13	93084535	splice site	probably benign
IGL02103:Cmya5	APN	13	93092127	missense	probably benign	0.05
IGL02174:Cmya5	APN	13	93048907	missense	possibly damaging	0.76
IGL02176:Cmya5	APN	13	93090150	missense	probably damaging	1.00
IGL02210:Cmya5	APN	13	93092734	missense	probably benign	0.14
IGL02229:Cmya5	APN	13	93092686	missense	possibly damaging	0.54
IGL02306:Cmya5	APN	13	93098019	missense	probably damaging	1.00
IGL02311:Cmya5	APN	13	93090655	missense	probably benign	0.40
IGL02409:Cmya5	APN	13	93090198	missense	probably damaging	0.96
IGL02561:Cmya5	APN	13	93091858	missense	probably benign	0.00
IGL02676:Cmya5	APN	13	93092853	missense	probably damaging	1.00
IGL02683:Cmya5	APN	13	93090997	nonsense	probably null
IGL02685:Cmya5	APN	13	93090997	nonsense	probably null
IGL02686:Cmya5	APN	13	93090997	nonsense	probably null
IGL02724:Cmya5	APN	13	93096655	missense	probably benign
IGL02727:Cmya5	APN	13	93098245	missense	possibly damaging	0.73
IGL02965:Cmya5	APN	13	93092557	missense	probably benign	0.41
IGL03079:Cmya5	APN	13	93097701	missense	possibly damaging	0.85
IGL03144:Cmya5	APN	13	93090868	missense	probably damaging	1.00
IGL03253:Cmya5	APN	13	93091270	nonsense	probably null
IGL03336:Cmya5	APN	13	93093505	missense	possibly damaging	0.84
IGL03138:Cmya5	UTSW	13	93065342	missense	probably damaging	1.00
P0023:Cmya5	UTSW	13	93089346	missense	probably benign	0.22
P4748:Cmya5	UTSW	13	93074475	splice site	probably benign
R0123:Cmya5	UTSW	13	93095904	missense	possibly damaging	0.84
R0206:Cmya5	UTSW	13	93095557	missense	probably damaging	0.98
R0206:Cmya5	UTSW	13	93095557	missense	probably damaging	0.98
R0242:Cmya5	UTSW	13	93095600	missense	probably benign
R0242:Cmya5	UTSW	13	93095600	missense	probably benign
R0331:Cmya5	UTSW	13	93144403	missense	possibly damaging	0.53
R0363:Cmya5	UTSW	13	93094869	missense	possibly damaging	0.77
R0382:Cmya5	UTSW	13	93092748	missense	probably benign	0.06
R0416:Cmya5	UTSW	13	93089856	missense	probably benign	0.05
R0446:Cmya5	UTSW	13	93093656	missense	probably benign
R0457:Cmya5	UTSW	13	93095587	missense	possibly damaging	0.84
R0673:Cmya5	UTSW	13	93089997	missense	probably damaging	1.00
R0674:Cmya5	UTSW	13	93092791	missense	probably damaging	1.00
R0692:Cmya5	UTSW	13	93093849	nonsense	probably null
R0698:Cmya5	UTSW	13	93095557	missense	probably damaging	0.98
R1227:Cmya5	UTSW	13	93094446	missense	probably damaging	0.99
R1272:Cmya5	UTSW	13	93095112	missense	possibly damaging	0.79
R1335:Cmya5	UTSW	13	93041535	missense	possibly damaging	0.65
R1353:Cmya5	UTSW	13	93041525	missense	probably damaging	1.00
R1354:Cmya5	UTSW	13	93092058	missense	possibly damaging	0.46
R1458:Cmya5	UTSW	13	93065327	missense	probably benign	0.44
R1572:Cmya5	UTSW	13	93094269	missense	possibly damaging	0.61
R1698:Cmya5	UTSW	13	93063519	missense	probably benign	0.27
R1735:Cmya5	UTSW	13	93089789	missense	probably benign	0.11
R1743:Cmya5	UTSW	13	93097317	missense	probably benign	0.33
R1750:Cmya5	UTSW	13	93095663	missense	probably benign
R1827:Cmya5	UTSW	13	93074448	missense	possibly damaging	0.80
R2068:Cmya5	UTSW	13	93090524	missense	possibly damaging	0.93
R2088:Cmya5	UTSW	13	93092812	missense	probably damaging	1.00
R2132:Cmya5	UTSW	13	93069383	missense	probably damaging	1.00
R2216:Cmya5	UTSW	13	93093495	missense	probably damaging	1.00
R2363:Cmya5	UTSW	13	93093702	missense	probably benign	0.15
R2497:Cmya5	UTSW	13	93098005	missense	possibly damaging	0.53
R2509:Cmya5	UTSW	13	93093558	missense	probably benign	0.41
R2917:Cmya5	UTSW	13	93091064	nonsense	probably null
R2944:Cmya5	UTSW	13	93092842	nonsense	probably null
R3039:Cmya5	UTSW	13	93092250	missense	probably benign	0.12
R3078:Cmya5	UTSW	13	93048927	missense	probably damaging	0.99
R3708:Cmya5	UTSW	13	93095366	nonsense	probably null
R3717:Cmya5	UTSW	13	93092487	missense	probably benign	0.12
R3768:Cmya5	UTSW	13	93096693	missense	possibly damaging	0.73
R3769:Cmya5	UTSW	13	93096693	missense	possibly damaging	0.73
R3840:Cmya5	UTSW	13	93094632	missense	probably damaging	0.96
R3841:Cmya5	UTSW	13	93094632	missense	probably damaging	0.96
R3882:Cmya5	UTSW	13	93091219	missense	probably benign	0.07
R3888:Cmya5	UTSW	13	93093656	missense	probably benign
R3897:Cmya5	UTSW	13	93096681	missense	possibly damaging	0.72
R3952:Cmya5	UTSW	13	93089199	missense	possibly damaging	0.89
R4366:Cmya5	UTSW	13	93091956	missense	probably benign	0.36
R4471:Cmya5	UTSW	13	93092325	missense	probably benign	0.01
R4493:Cmya5	UTSW	13	93094065	missense	probably benign
R4495:Cmya5	UTSW	13	93094065	missense	probably benign
R4544:Cmya5	UTSW	13	93091918	nonsense	probably null
R4545:Cmya5	UTSW	13	93091918	nonsense	probably null
R4624:Cmya5	UTSW	13	93063551	missense	probably damaging	1.00
R4648:Cmya5	UTSW	13	93093828	missense	possibly damaging	0.84
R4824:Cmya5	UTSW	13	93093574	missense	probably benign	0.04
R4965:Cmya5	UTSW	13	93095787	missense	possibly damaging	0.84
R4967:Cmya5	UTSW	13	93090585	missense	probably damaging	1.00
R5101:Cmya5	UTSW	13	93091603	missense	possibly damaging	0.61
R5133:Cmya5	UTSW	13	93093372	missense	possibly damaging	0.79
R5139:Cmya5	UTSW	13	93096061	missense	probably benign	0.00
R5220:Cmya5	UTSW	13	93092296	missense	probably damaging	0.99
R5332:Cmya5	UTSW	13	93096195	missense	probably damaging	0.96
R5337:Cmya5	UTSW	13	93083273	missense	probably benign	0.28
R5356:Cmya5	UTSW	13	93063485	missense	probably damaging	1.00
R5401:Cmya5	UTSW	13	93091968	missense	probably damaging	1.00
R5438:Cmya5	UTSW	13	93095199	missense	possibly damaging	0.89
R5604:Cmya5	UTSW	13	93092763	missense	probably benign	0.15
R5628:Cmya5	UTSW	13	93089710	missense	probably damaging	1.00
R5666:Cmya5	UTSW	13	93045949	missense	possibly damaging	0.75
R5687:Cmya5	UTSW	13	93098176	missense	possibly damaging	0.53
R5695:Cmya5	UTSW	13	93045866	critical splice donor site	probably null
R5806:Cmya5	UTSW	13	93093937	missense	possibly damaging	0.84
R5820:Cmya5	UTSW	13	93092780	missense	probably benign	0.04
R5872:Cmya5	UTSW	13	93097435	missense	probably benign	0.01
R5875:Cmya5	UTSW	13	93095184	missense	probably benign	0.13
R5896:Cmya5	UTSW	13	93045865	critical splice donor site	probably null
R5910:Cmya5	UTSW	13	93092643	missense	probably damaging	0.98
R5969:Cmya5	UTSW	13	93089544	missense	possibly damaging	0.78
R6064:Cmya5	UTSW	13	93089649	missense	probably damaging	1.00
R6081:Cmya5	UTSW	13	93144513	unclassified	probably benign
R6102:Cmya5	UTSW	13	93094231	missense	probably benign
R6117:Cmya5	UTSW	13	93095166	missense	probably damaging	0.98
R6188:Cmya5	UTSW	13	93093444	missense	possibly damaging	0.61
R6188:Cmya5	UTSW	13	93097276	missense	possibly damaging	0.73
R6219:Cmya5	UTSW	13	93094443	missense	probably damaging	1.00
R6229:Cmya5	UTSW	13	93093306	missense	probably benign	0.41
R6346:Cmya5	UTSW	13	93092190	missense	probably damaging	1.00
R6431:Cmya5	UTSW	13	93074464	missense	possibly damaging	0.60
R6436:Cmya5	UTSW	13	93089215	missense	probably damaging	0.98
R6598:Cmya5	UTSW	13	93089808	missense	probably benign	0.05
R6649:Cmya5	UTSW	13	93098025	missense	possibly damaging	0.91
R6652:Cmya5	UTSW	13	93092895	missense	probably benign	0.04
R6652:Cmya5	UTSW	13	93093039	missense	probably damaging	0.99
R6669:Cmya5	UTSW	13	93093259	missense	probably benign	0.03
R6881:Cmya5	UTSW	13	93090292	missense	probably damaging	1.00
R6909:Cmya5	UTSW	13	93091252	missense	probably benign	0.04
R6933:Cmya5	UTSW	13	93095136	missense	probably benign	0.03
R7021:Cmya5	UTSW	13	93093555	missense	possibly damaging	0.62
R7022:Cmya5	UTSW	13	93069278	critical splice donor site	probably null
R7068:Cmya5	UTSW	13	93092697	missense	possibly damaging	0.59
R7087:Cmya5	UTSW	13	93090975	missense	probably benign	0.00
R7088:Cmya5	UTSW	13	93091864	missense	possibly damaging	0.95
R7126:Cmya5	UTSW	13	93089940	missense	probably benign	0.41
R7177:Cmya5	UTSW	13	93095328	missense	probably benign	0.00
R7188:Cmya5	UTSW	13	93046038	missense	probably damaging	1.00
R7217:Cmya5	UTSW	13	93090430	missense	probably damaging	1.00
R7293:Cmya5	UTSW	13	93092797	missense	possibly damaging	0.90
R7332:Cmya5	UTSW	13	93092553	missense	possibly damaging	0.60
R7375:Cmya5	UTSW	13	93091661	missense	probably damaging	0.97
R7386:Cmya5	UTSW	13	93069323	missense	probably damaging	1.00
R7489:Cmya5	UTSW	13	93091838	missense	possibly damaging	0.87
R7529:Cmya5	UTSW	13	93097434	missense	probably benign	0.02
R7552:Cmya5	UTSW	13	93069312	missense	probably benign	0.41
R7624:Cmya5	UTSW	13	93090357	missense	possibly damaging	0.79
R7637:Cmya5	UTSW	13	93083212	missense	possibly damaging	0.87
R7673:Cmya5	UTSW	13	93094121	missense	probably benign	0.13
R7753:Cmya5	UTSW	13	93098172	missense	probably benign	0.18
R7757:Cmya5	UTSW	13	93098272	missense	possibly damaging	0.53
R7806:Cmya5	UTSW	13	93094262	missense	probably benign	0.00
R7825:Cmya5	UTSW	13	93097628	missense	possibly damaging	0.53
R7878:Cmya5	UTSW	13	93089757	missense	probably damaging	0.98
R7892:Cmya5	UTSW	13	93096357	missense	probably damaging	0.96
R7952:Cmya5	UTSW	13	93097004	small deletion	probably benign
R8127:Cmya5	UTSW	13	93094614	missense	probably damaging	0.99
R8256:Cmya5	UTSW	13	93093478	missense	possibly damaging	0.62
R8339:Cmya5	UTSW	13	93091634	nonsense	probably null
R8446:Cmya5	UTSW	13	93093828	missense	possibly damaging	0.84
R8553:Cmya5	UTSW	13	93093796	missense	probably benign	0.00
R8686:Cmya5	UTSW	13	93095380	missense	possibly damaging	0.91
R8748:Cmya5	UTSW	13	93089721	missense	probably damaging	1.00
R8783:Cmya5	UTSW	13	93089380	missense	possibly damaging	0.58
R8803:Cmya5	UTSW	13	93041483	missense	probably damaging	1.00
R8810:Cmya5	UTSW	13	93063540	missense	possibly damaging	0.47
R8937:Cmya5	UTSW	13	93096332	missense	probably benign	0.01
R8985:Cmya5	UTSW	13	93097156	missense	possibly damaging	0.73
R9017:Cmya5	UTSW	13	93092064	missense	probably benign	0.03
R9087:Cmya5	UTSW	13	93097203	missense	possibly damaging	0.72
R9133:Cmya5	UTSW	13	93097600	missense	possibly damaging	0.73
R9156:Cmya5	UTSW	13	93097370	missense	unknown
R9209:Cmya5	UTSW	13	93090358	missense	probably benign	0.45
R9222:Cmya5	UTSW	13	93094071	missense	probably benign	0.00
R9229:Cmya5	UTSW	13	93095668	missense	possibly damaging	0.92
R9382:Cmya5	UTSW	13	93093376	missense	probably benign
R9385:Cmya5	UTSW	13	93094372	missense	probably damaging	0.99
R9418:Cmya5	UTSW	13	93089701	missense	probably benign	0.22
R9452:Cmya5	UTSW	13	93095886	missense	probably benign
R9492:Cmya5	UTSW	13	93041314	makesense	probably null
R9600:Cmya5	UTSW	13	93090096	missense	probably damaging	1.00
R9712:Cmya5	UTSW	13	93065373	critical splice acceptor site	probably null
R9742:Cmya5	UTSW	13	93095427	missense	possibly damaging	0.89
RF020:Cmya5	UTSW	13	93069291	missense	possibly damaging	0.56
X0028:Cmya5	UTSW	13	93096687	missense	possibly damaging	0.53
Z1088:Cmya5	UTSW	13	93063579	missense	probably benign
Z1176:Cmya5	UTSW	13	93063579	missense	probably benign
Z1176:Cmya5	UTSW	13	93096790	missense	unknown
Z1177:Cmya5	UTSW	13	93063579	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGAGGCACCCTTTAGAAGC -3'
(R):5'- CCAGGCAGTTCTATCGGAAG -3'

Sequencing Primer
(F):5'- AGATGTGTGGCCAAGCTC -3'
(R):5'- TCGGAAGATGAGAGTCTAGGAAGTG -3'

Posted On

2019-09-13