Incidental Mutation 'R7278:Ripk3'
ID571577
Institutional Source Beutler Lab
Gene Symbol Ripk3
Ensembl Gene ENSMUSG00000022221
Gene Namereceptor-interacting serine-threonine kinase 3
SynonymsRip3, 2610528K09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7278 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location55784995-55788865 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 55787284 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 210 (Y210*)
Ref Sequence ENSEMBL: ENSMUSP00000022830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002398] [ENSMUST00000022830] [ENSMUST00000168716] [ENSMUST00000170223] [ENSMUST00000178399] [ENSMUST00000227031] [ENSMUST00000228326] [ENSMUST00000228476]
PDB Structure
Crystal structure of the mouse RIP3 kinase domain [X-RAY DIFFRACTION]
Crystal structure of the mouse RIP3-MLKL complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000002398
SMART Domains Protein: ENSMUSP00000002398
Gene: ENSMUSG00000022220

DomainStartEndE-ValueType
low complexity region 28 48 N/A INTRINSIC
low complexity region 66 80 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
CYCc 218 426 1.56e-62 SMART
Pfam:DUF1053 479 581 2.4e-35 PFAM
transmembrane domain 607 629 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 746 768 N/A INTRINSIC
transmembrane domain 792 809 N/A INTRINSIC
CYCc 835 1057 4.46e-40 SMART
Predicted Effect probably null
Transcript: ENSMUST00000022830
AA Change: Y210*
SMART Domains Protein: ENSMUSP00000022830
Gene: ENSMUSG00000022221
AA Change: Y210*

DomainStartEndE-ValueType
Pfam:Pkinase 22 288 2.8e-38 PFAM
Pfam:Pkinase_Tyr 22 288 3e-34 PFAM
Pfam:RHIM 408 458 2.4e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000168716
AA Change: Y146*
SMART Domains Protein: ENSMUSP00000126306
Gene: ENSMUSG00000022221
AA Change: Y146*

DomainStartEndE-ValueType
Pfam:Pkinase 1 223 1.2e-30 PFAM
Pfam:Pkinase_Tyr 1 224 3.1e-27 PFAM
Pfam:RHIM 344 395 2.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170223
SMART Domains Protein: ENSMUSP00000130530
Gene: ENSMUSG00000022220

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 61 80 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 119 138 N/A INTRINSIC
transmembrane domain 145 162 N/A INTRINSIC
transmembrane domain 172 194 N/A INTRINSIC
CYCc 218 426 1.56e-62 SMART
Pfam:DUF1053 479 581 1.6e-24 PFAM
transmembrane domain 607 629 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 746 768 N/A INTRINSIC
transmembrane domain 792 809 N/A INTRINSIC
CYCc 835 1057 4.46e-40 SMART
Predicted Effect probably null
Transcript: ENSMUST00000178399
AA Change: Y146*
SMART Domains Protein: ENSMUSP00000137278
Gene: ENSMUSG00000022221
AA Change: Y146*

DomainStartEndE-ValueType
Pfam:Pkinase 1 223 1.2e-30 PFAM
Pfam:Pkinase_Tyr 1 224 3.1e-27 PFAM
Pfam:RHIM 344 395 2.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227031
Predicted Effect probably null
Transcript: ENSMUST00000228326
AA Change: Y146*
Predicted Effect probably benign
Transcript: ENSMUST00000228476
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases, and contains a C-terminal domain unique from other RIP family members. The encoded protein is predominantly localized to the cytoplasm, and can undergo nucleocytoplasmic shuttling dependent on novel nuclear localization and export signals. It is a component of the tumor necrosis factor (TNF) receptor-I signaling complex, and can induce apoptosis and weakly activate the NF-kappaB transcription factor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out alleles exhibit resistance to induced inflammatory responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,065,476 L142P probably benign Het
Abca13 A T 11: 9,291,126 R996S possibly damaging Het
Abcb6 A G 1: 75,174,373 F558L possibly damaging Het
Acp7 T A 7: 28,630,882 D2V unknown Het
Acvr1c T C 2: 58,284,936 D280G probably damaging Het
Atp8a1 A G 5: 67,624,037 S1124P Het
B4galnt1 A T 10: 127,167,788 T207S probably benign Het
C2cd4d C A 3: 94,364,138 T237N probably benign Het
C8b T C 4: 104,780,627 C99R probably damaging Het
Ccnk C A 12: 108,193,705 Q149K possibly damaging Het
Chfr A G 5: 110,140,360 D47G probably benign Het
Chid1 A T 7: 141,529,488 probably null Het
Cmya5 T A 13: 93,095,700 E960V probably damaging Het
Col18a1 A G 10: 77,096,284 S112P unknown Het
Cps1 G A 1: 67,170,921 V637I probably damaging Het
Crispld1 A G 1: 17,752,878 T390A probably benign Het
Cyp2c54 A T 19: 40,070,253 L245* probably null Het
Ddr2 G T 1: 169,984,961 T654K probably damaging Het
Dnah10 T C 5: 124,791,791 probably null Het
Elavl4 C T 4: 110,211,425 probably null Het
Emilin1 T C 5: 30,920,660 V921A probably benign Het
Evpl T A 11: 116,223,113 E1250D probably damaging Het
Fam228a C T 12: 4,732,790 G101E probably benign Het
Fam92b T A 8: 120,168,603 T187S possibly damaging Het
Gemin4 T C 11: 76,212,106 T610A probably damaging Het
Glis1 T C 4: 107,435,683 M1T probably null Het
Gm14399 C T 2: 175,130,459 probably benign Het
Gorasp2 C T 2: 70,679,505 T170I probably damaging Het
Gpr37 A G 6: 25,669,342 V501A possibly damaging Het
Grik4 T A 9: 42,622,060 Q388L probably benign Het
Hspg2 T A 4: 137,551,125 D3035E probably damaging Het
Htr4 A T 18: 62,412,176 N11Y probably benign Het
Itgb2l A G 16: 96,429,043 S356P probably damaging Het
Klk1b22 A G 7: 44,114,749 N34D probably benign Het
Lmcd1 A G 6: 112,310,539 D62G possibly damaging Het
Lrp2 C T 2: 69,486,352 G2095E probably damaging Het
Macf1 T A 4: 123,440,743 E4407V possibly damaging Het
Mcm5 T C 8: 75,124,859 F631L probably benign Het
Mov10l1 A G 15: 88,993,868 S170G probably benign Het
Muc5b A T 7: 141,857,502 D1395V unknown Het
Muc6 G A 7: 141,640,575 T1395M probably benign Het
Myh15 A G 16: 49,091,105 D300G probably damaging Het
Nat6 T C 9: 107,583,299 L131P probably damaging Het
Ndst4 A G 3: 125,438,303 T174A probably benign Het
Nek5 T A 8: 22,090,484 N406I probably benign Het
Nr2c2 G A 6: 92,159,378 V400I probably damaging Het
Olfr364-ps1 G T 2: 37,147,009 V266L probably benign Het
Olfr365 T C 2: 37,202,080 Y280H probably damaging Het
Olfr449 G A 6: 42,834,396 probably null Het
Olfr554 T C 7: 102,640,983 S246P probably damaging Het
Olfr612 A T 7: 103,538,728 Y169N probably benign Het
Olfr787 T A 10: 129,462,751 I25N probably damaging Het
Parn T C 16: 13,626,063 probably null Het
Pfkl T C 10: 77,992,023 T468A probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Plce1 T C 19: 38,779,896 I2205T possibly damaging Het
Prss16 A T 13: 22,003,147 N442K probably damaging Het
Pus7 A G 5: 23,752,344 S370P probably damaging Het
Rps6ka2 C A 17: 7,271,635 F317L probably damaging Het
Slc13a3 G A 2: 165,445,528 R169W possibly damaging Het
Slc6a21 T A 7: 45,282,480 I256N possibly damaging Het
Slc6a9 G A 4: 117,868,106 R589Q probably benign Het
Slc8a2 T C 7: 16,141,152 S442P probably damaging Het
Snupn T A 9: 56,982,744 M283K probably damaging Het
Steap3 A T 1: 120,234,357 M395K probably damaging Het
Sv2b G A 7: 75,147,654 P331S probably damaging Het
Tlr1 A G 5: 64,926,772 V154A probably benign Het
Tmem131 A G 1: 36,796,301 S1580P probably damaging Het
Tmem51 TCCCC TCCC 4: 142,037,685 probably null Het
Trav14d-3-dv8 G A 14: 53,078,761 R26H probably benign Het
Trp53 C T 11: 69,591,255 L365F probably benign Het
Trp53bp1 A T 2: 121,199,035 I1838N probably damaging Het
Ugt1a5 A T 1: 88,166,886 K279* probably null Het
Unc80 A G 1: 66,552,209 E1141G possibly damaging Het
Vti1b T C 12: 79,166,379 D49G probably benign Het
Wnt10a A T 1: 74,793,482 H78L possibly damaging Het
Zfp869 G A 8: 69,706,478 H482Y probably damaging Het
Zfyve1 A G 12: 83,551,540 V638A probably damaging Het
Other mutations in Ripk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Ripk3 APN 14 55786027 missense probably damaging 1.00
IGL02073:Ripk3 APN 14 55786025 critical splice donor site probably null
IGL02420:Ripk3 APN 14 55785234 missense probably benign 0.02
IGL03033:Ripk3 APN 14 55787165 unclassified probably benign
IGL03036:Ripk3 APN 14 55787339 missense probably benign 0.01
R0211:Ripk3 UTSW 14 55787918 missense probably damaging 1.00
R0352:Ripk3 UTSW 14 55786743 unclassified probably benign
R0366:Ripk3 UTSW 14 55786835 missense probably damaging 0.99
R0634:Ripk3 UTSW 14 55788391 unclassified probably benign
R1364:Ripk3 UTSW 14 55785260 unclassified probably null
R1665:Ripk3 UTSW 14 55786351 missense probably benign 0.24
R1794:Ripk3 UTSW 14 55785329 missense probably benign 0.45
R1886:Ripk3 UTSW 14 55788237 critical splice donor site probably null
R2517:Ripk3 UTSW 14 55788035 missense probably damaging 0.97
R3409:Ripk3 UTSW 14 55788241 missense probably damaging 0.99
R3806:Ripk3 UTSW 14 55786268 missense probably benign 0.00
R5807:Ripk3 UTSW 14 55785298 missense probably damaging 1.00
R7138:Ripk3 UTSW 14 55788346 missense probably benign
R8064:Ripk3 UTSW 14 55787926 missense possibly damaging 0.94
Z1088:Ripk3 UTSW 14 55787926 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACACTCAGCTTCTCTGCCAG -3'
(R):5'- CATCTTCTGGGGAGCAAGAG -3'

Sequencing Primer
(F):5'- TCTCTGCCAGCCAGCACTG -3'
(R):5'- GAGAGGGAAAAATCTCTGACCCC -3'
Posted On2019-09-13