Incidental Mutation 'R7278:Myh15'
ID 571579
Institutional Source Beutler Lab
Gene Symbol Myh15
Ensembl Gene ENSMUSG00000092009
Gene Name myosin, heavy chain 15
Synonyms EG667772
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock # R7278 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 49057486-49199104 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 49091105 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 300 (D300G)
Ref Sequence ENSEMBL: ENSMUSP00000127539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168680]
AlphaFold E9Q264
Predicted Effect probably damaging
Transcript: ENSMUST00000168680
AA Change: D300G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127539
Gene: ENSMUSG00000092009
AA Change: D300G

DomainStartEndE-ValueType
Pfam:Myosin_N 30 70 5.2e-12 PFAM
MYSc 76 770 N/A SMART
Pfam:Myosin_tail_1 836 1915 9.5e-118 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (78/79)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,065,476 L142P probably benign Het
Abca13 A T 11: 9,291,126 R996S possibly damaging Het
Abcb6 A G 1: 75,174,373 F558L possibly damaging Het
Acp7 T A 7: 28,630,882 D2V unknown Het
Acvr1c T C 2: 58,284,936 D280G probably damaging Het
Atp8a1 A G 5: 67,624,037 S1124P Het
B4galnt1 A T 10: 127,167,788 T207S probably benign Het
C2cd4d C A 3: 94,364,138 T237N probably benign Het
C8b T C 4: 104,780,627 C99R probably damaging Het
Ccnk C A 12: 108,193,705 Q149K possibly damaging Het
Chfr A G 5: 110,140,360 D47G probably benign Het
Chid1 A T 7: 141,529,488 probably null Het
Cmya5 T A 13: 93,095,700 E960V probably damaging Het
Col18a1 A G 10: 77,096,284 S112P unknown Het
Cps1 G A 1: 67,170,921 V637I probably damaging Het
Crispld1 A G 1: 17,752,878 T390A probably benign Het
Cyp2c54 A T 19: 40,070,253 L245* probably null Het
Ddr2 G T 1: 169,984,961 T654K probably damaging Het
Dnah10 T C 5: 124,791,791 probably null Het
Elavl4 C T 4: 110,211,425 probably null Het
Emilin1 T C 5: 30,920,660 V921A probably benign Het
Evpl T A 11: 116,223,113 E1250D probably damaging Het
Fam228a C T 12: 4,732,790 G101E probably benign Het
Fam92b T A 8: 120,168,603 T187S possibly damaging Het
Gemin4 T C 11: 76,212,106 T610A probably damaging Het
Glis1 T C 4: 107,435,683 M1T probably null Het
Gm14399 C T 2: 175,130,459 probably benign Het
Gorasp2 C T 2: 70,679,505 T170I probably damaging Het
Gpr37 A G 6: 25,669,342 V501A possibly damaging Het
Grik4 T A 9: 42,622,060 Q388L probably benign Het
Hspg2 T A 4: 137,551,125 D3035E probably damaging Het
Htr4 A T 18: 62,412,176 N11Y probably benign Het
Itgb2l A G 16: 96,429,043 S356P probably damaging Het
Klk1b22 A G 7: 44,114,749 N34D probably benign Het
Lmcd1 A G 6: 112,310,539 D62G possibly damaging Het
Lrp2 C T 2: 69,486,352 G2095E probably damaging Het
Macf1 T A 4: 123,440,743 E4407V possibly damaging Het
Mcm5 T C 8: 75,124,859 F631L probably benign Het
Mov10l1 A G 15: 88,993,868 S170G probably benign Het
Muc5b A T 7: 141,857,502 D1395V unknown Het
Muc6 G A 7: 141,640,575 T1395M probably benign Het
Nat6 T C 9: 107,583,299 L131P probably damaging Het
Ndst4 A G 3: 125,438,303 T174A probably benign Het
Nek5 T A 8: 22,090,484 N406I probably benign Het
Nr2c2 G A 6: 92,159,378 V400I probably damaging Het
Olfr364-ps1 G T 2: 37,147,009 V266L probably benign Het
Olfr365 T C 2: 37,202,080 Y280H probably damaging Het
Olfr449 G A 6: 42,834,396 probably null Het
Olfr554 T C 7: 102,640,983 S246P probably damaging Het
Olfr612 A T 7: 103,538,728 Y169N probably benign Het
Olfr787 T A 10: 129,462,751 I25N probably damaging Het
Parn T C 16: 13,626,063 probably null Het
Pfkl T C 10: 77,992,023 T468A probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Plce1 T C 19: 38,779,896 I2205T possibly damaging Het
Prss16 A T 13: 22,003,147 N442K probably damaging Het
Pus7 A G 5: 23,752,344 S370P probably damaging Het
Ripk3 G T 14: 55,787,284 Y210* probably null Het
Rps6ka2 C A 17: 7,271,635 F317L probably damaging Het
Slc13a3 G A 2: 165,445,528 R169W possibly damaging Het
Slc6a21 T A 7: 45,282,480 I256N possibly damaging Het
Slc6a9 G A 4: 117,868,106 R589Q probably benign Het
Slc8a2 T C 7: 16,141,152 S442P probably damaging Het
Snupn T A 9: 56,982,744 M283K probably damaging Het
Steap3 A T 1: 120,234,357 M395K probably damaging Het
Sv2b G A 7: 75,147,654 P331S probably damaging Het
Tlr1 A G 5: 64,926,772 V154A probably benign Het
Tmem131 A G 1: 36,796,301 S1580P probably damaging Het
Tmem51 TCCCC TCCC 4: 142,037,685 probably null Het
Trav14d-3-dv8 G A 14: 53,078,761 R26H probably benign Het
Trp53 C T 11: 69,591,255 L365F probably benign Het
Trp53bp1 A T 2: 121,199,035 I1838N probably damaging Het
Ugt1a5 A T 1: 88,166,886 K279* probably null Het
Unc80 A G 1: 66,552,209 E1141G possibly damaging Het
Vti1b T C 12: 79,166,379 D49G probably benign Het
Wnt10a A T 1: 74,793,482 H78L possibly damaging Het
Zfp869 G A 8: 69,706,478 H482Y probably damaging Het
Zfyve1 A G 12: 83,551,540 V638A probably damaging Het
Other mutations in Myh15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Myh15 APN 16 49165813 missense probably damaging 0.98
IGL01095:Myh15 APN 16 49132015 missense probably damaging 1.00
IGL01343:Myh15 APN 16 49155677 missense probably benign 0.09
IGL01474:Myh15 APN 16 49132098 missense probably damaging 1.00
IGL01572:Myh15 APN 16 49100222 missense possibly damaging 0.55
IGL01595:Myh15 APN 16 49172949 missense probably damaging 1.00
IGL01632:Myh15 APN 16 49061511 missense probably benign 0.00
IGL01638:Myh15 APN 16 49069480 missense probably damaging 1.00
IGL01667:Myh15 APN 16 49195579 missense probably benign 0.20
IGL01715:Myh15 APN 16 49057484 unclassified probably benign
IGL01833:Myh15 APN 16 49114058 missense probably damaging 1.00
IGL02004:Myh15 APN 16 49110529 splice site probably benign
IGL02033:Myh15 APN 16 49145344 missense probably benign 0.05
IGL02148:Myh15 APN 16 49116315 missense probably damaging 1.00
IGL02225:Myh15 APN 16 49091163 missense probably benign 0.14
IGL02249:Myh15 APN 16 49110484 missense probably damaging 0.99
IGL02505:Myh15 APN 16 49117263 missense possibly damaging 0.90
IGL02622:Myh15 APN 16 49176954 missense probably benign 0.02
IGL02814:Myh15 APN 16 49145438 splice site probably benign
IGL02869:Myh15 APN 16 49145404 missense probably benign
IGL02879:Myh15 APN 16 49173059 missense possibly damaging 0.68
IGL02881:Myh15 APN 16 49117265 missense possibly damaging 0.51
IGL03077:Myh15 APN 16 49096538 missense probably benign 0.10
IGL03354:Myh15 APN 16 49172010 missense probably benign 0.01
IGL03411:Myh15 APN 16 49159967 missense possibly damaging 0.58
ANU74:Myh15 UTSW 16 49172932 missense possibly damaging 0.58
P0027:Myh15 UTSW 16 49081208 missense possibly damaging 0.77
PIT1430001:Myh15 UTSW 16 49196891 critical splice donor site probably null
R0017:Myh15 UTSW 16 49163060 missense probably damaging 0.97
R0038:Myh15 UTSW 16 49071141 splice site probably benign
R0149:Myh15 UTSW 16 49114005 missense probably benign 0.01
R0361:Myh15 UTSW 16 49114005 missense probably benign 0.01
R0373:Myh15 UTSW 16 49182959 missense possibly damaging 0.86
R0433:Myh15 UTSW 16 49145236 missense probably damaging 1.00
R0525:Myh15 UTSW 16 49132051 missense probably benign 0.03
R0586:Myh15 UTSW 16 49171887 splice site probably benign
R0601:Myh15 UTSW 16 49061581 missense probably damaging 1.00
R0717:Myh15 UTSW 16 49142993 missense probably benign 0.03
R0963:Myh15 UTSW 16 49132149 missense probably damaging 0.97
R1075:Myh15 UTSW 16 49120054 missense possibly damaging 0.63
R1143:Myh15 UTSW 16 49065086 missense probably benign 0.02
R1200:Myh15 UTSW 16 49096519 missense probably damaging 1.00
R1644:Myh15 UTSW 16 49132203 missense probably benign 0.12
R1646:Myh15 UTSW 16 49195568 missense probably damaging 1.00
R1720:Myh15 UTSW 16 49092782 missense probably damaging 1.00
R1768:Myh15 UTSW 16 49163135 missense probably benign 0.27
R1881:Myh15 UTSW 16 49071083 missense probably damaging 0.98
R2048:Myh15 UTSW 16 49155565 missense probably damaging 0.99
R2064:Myh15 UTSW 16 49155621 missense possibly damaging 0.50
R2184:Myh15 UTSW 16 49137511 missense probably damaging 0.99
R2212:Myh15 UTSW 16 49138732 missense probably benign 0.02
R2216:Myh15 UTSW 16 49165838 nonsense probably null
R2321:Myh15 UTSW 16 49113073 missense possibly damaging 0.93
R2327:Myh15 UTSW 16 49142950 missense probably benign 0.01
R2395:Myh15 UTSW 16 49069514 missense probably benign 0.04
R2399:Myh15 UTSW 16 49137589 missense probably damaging 0.97
R3413:Myh15 UTSW 16 49138732 missense probably benign 0.02
R4234:Myh15 UTSW 16 49163042 missense probably benign 0.04
R4382:Myh15 UTSW 16 49142943 missense probably benign 0.03
R4421:Myh15 UTSW 16 49109344 missense probably damaging 0.99
R4580:Myh15 UTSW 16 49065025 missense possibly damaging 0.93
R4657:Myh15 UTSW 16 49172058 nonsense probably null
R4780:Myh15 UTSW 16 49120057 missense probably benign 0.13
R5004:Myh15 UTSW 16 49132048 missense probably damaging 0.99
R5175:Myh15 UTSW 16 49069426 missense possibly damaging 0.85
R5189:Myh15 UTSW 16 49101507 missense probably benign 0.20
R5311:Myh15 UTSW 16 49165841 missense possibly damaging 0.94
R5318:Myh15 UTSW 16 49110471 missense probably damaging 0.99
R5404:Myh15 UTSW 16 49159978 missense probably benign 0.15
R5415:Myh15 UTSW 16 49117295 missense probably null 1.00
R5558:Myh15 UTSW 16 49069537 missense probably benign 0.32
R5977:Myh15 UTSW 16 49153503 missense probably damaging 1.00
R6004:Myh15 UTSW 16 49159699 missense probably benign 0.00
R6275:Myh15 UTSW 16 49145247 missense probably benign 0.00
R6381:Myh15 UTSW 16 49101481 missense probably damaging 1.00
R6448:Myh15 UTSW 16 49171932 missense probably damaging 0.99
R6516:Myh15 UTSW 16 49137633 missense probably benign 0.19
R6752:Myh15 UTSW 16 49182927 missense probably damaging 1.00
R6847:Myh15 UTSW 16 49145088 missense possibly damaging 0.70
R6868:Myh15 UTSW 16 49069403 missense probably damaging 1.00
R6889:Myh15 UTSW 16 49153111 missense possibly damaging 0.75
R6896:Myh15 UTSW 16 49113071 missense probably benign 0.44
R6955:Myh15 UTSW 16 49081235 critical splice donor site probably null
R6984:Myh15 UTSW 16 49110412 missense probably damaging 1.00
R7046:Myh15 UTSW 16 49109299 nonsense probably null
R7095:Myh15 UTSW 16 49171909 missense possibly damaging 0.90
R7098:Myh15 UTSW 16 49177057 missense possibly damaging 0.53
R7134:Myh15 UTSW 16 49081342 missense possibly damaging 0.86
R7159:Myh15 UTSW 16 49061574 missense probably damaging 0.97
R7244:Myh15 UTSW 16 49196786 missense probably damaging 1.00
R7309:Myh15 UTSW 16 49096465 missense probably benign 0.34
R7327:Myh15 UTSW 16 49173006 missense possibly damaging 0.88
R7418:Myh15 UTSW 16 49155537 missense possibly damaging 0.69
R7937:Myh15 UTSW 16 49155646 missense probably benign 0.00
R8053:Myh15 UTSW 16 49142939 missense possibly damaging 0.89
R8313:Myh15 UTSW 16 49120018 missense probably damaging 0.99
R8315:Myh15 UTSW 16 49120018 missense probably damaging 0.99
R8316:Myh15 UTSW 16 49120018 missense probably damaging 0.99
R8317:Myh15 UTSW 16 49120018 missense probably damaging 0.99
R8342:Myh15 UTSW 16 49092757 missense probably benign
R8379:Myh15 UTSW 16 49081188 missense probably benign
R8445:Myh15 UTSW 16 49120018 missense probably damaging 0.99
R8707:Myh15 UTSW 16 49153087 missense probably damaging 1.00
R8729:Myh15 UTSW 16 49061488 missense probably damaging 0.97
R8773:Myh15 UTSW 16 49195537 missense possibly damaging 0.89
R8869:Myh15 UTSW 16 49177003 missense probably benign
R8890:Myh15 UTSW 16 49138767 missense probably damaging 1.00
R9026:Myh15 UTSW 16 49187070 missense probably damaging 1.00
R9063:Myh15 UTSW 16 49092755 missense probably benign 0.00
R9290:Myh15 UTSW 16 49177012 missense probably damaging 1.00
X0012:Myh15 UTSW 16 49142978 missense probably damaging 1.00
X0020:Myh15 UTSW 16 49165874 missense probably damaging 1.00
Z1176:Myh15 UTSW 16 49096531 missense probably damaging 0.98
Z1177:Myh15 UTSW 16 49081228 missense probably benign 0.02
Z1177:Myh15 UTSW 16 49155618 missense probably damaging 0.97
Z1177:Myh15 UTSW 16 49159826 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGGCCTTGACACATGACTGAC -3'
(R):5'- TTCAAAAGGAGCAAGGCCAC -3'

Sequencing Primer
(F):5'- AATAGTGATGATAGAGGTGTGCGTC -3'
(R):5'- CGTCTCCAGACCTGCAGATGATG -3'
Posted On 2019-09-13