Mutagenetix > Incidental Mutation

Incidental Mutation 'R7278:Plce1'

571584

Institutional Source

Beutler Lab

Gene Symbol

Plce1

Ensembl Gene

ENSMUSG00000024998

Gene Name

phospholipase C, epsilon 1

Synonyms

4933403A21Rik, PLCepsilon

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.611) question?

Stock #

R7278 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

38481109-38785030 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 38779896 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 2205 (I2205T)

Ref Sequence

ENSEMBL: ENSMUSP00000138330 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169713] [ENSMUST00000182267] [ENSMUST00000182481]

AlphaFold

Q8K4S1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169713
AA Change: I2191T

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000130604
Gene: ENSMUSG00000024998
AA Change: I2191T

Domain	Start	End	E-Value	Type
low complexity region	471	489	N/A	INTRINSIC
RasGEF	525	828	8.06e-9	SMART
low complexity region	1162	1172	N/A	INTRINSIC
Pfam:EF-hand_like	1305	1369	7.6e-11	PFAM
PLCXc	1373	1521	1.05e-81	SMART
low complexity region	1561	1575	N/A	INTRINSIC
SCOP:d1qasa3	1634	1662	1e-3	SMART
low complexity region	1666	1680	N/A	INTRINSIC
PLCYc	1710	1826	4.28e-46	SMART
C2	1850	1948	3.7e-10	SMART
PDB:2BYE\|A	1986	2094	6e-47	PDB
RA	2115	2218	1.12e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000182267
AA Change: I2205T

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000138330
Gene: ENSMUSG00000024998
AA Change: I2205T

Domain	Start	End	E-Value	Type
low complexity region	471	489	N/A	INTRINSIC
RasGEF	525	828	8.06e-9	SMART
low complexity region	1162	1172	N/A	INTRINSIC
Pfam:EF-hand_like	1305	1369	5.9e-11	PFAM
PLCXc	1373	1521	1.05e-81	SMART
low complexity region	1552	1581	N/A	INTRINSIC
SCOP:d1qasa3	1648	1676	1e-3	SMART
low complexity region	1680	1694	N/A	INTRINSIC
PLCYc	1724	1840	4.28e-46	SMART
C2	1864	1962	3.7e-10	SMART
PDB:2BYE\|A	2000	2108	6e-47	PDB
RA	2129	2232	1.12e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000182481
AA Change: I2191T

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000138360
Gene: ENSMUSG00000024998
AA Change: I2191T

Domain	Start	End	E-Value	Type
low complexity region	471	489	N/A	INTRINSIC
RasGEF	525	828	8.06e-9	SMART
low complexity region	1162	1172	N/A	INTRINSIC
Pfam:EF-hand_like	1305	1369	8e-11	PFAM
PLCXc	1373	1521	1.05e-81	SMART
low complexity region	1561	1575	N/A	INTRINSIC
SCOP:d1qasa3	1634	1662	1e-3	SMART
low complexity region	1666	1680	N/A	INTRINSIC
PLCYc	1710	1826	4.28e-46	SMART
C2	1850	1948	3.7e-10	SMART
PDB:2BYE\|A	1986	2094	6e-47	PDB
RA	2115	2218	1.12e-2	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (78/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase enzyme that catalyzes the hydrolysis of phosphatidylinositol-4,5-bisphosphate to generate two second messengers: inositol 1,4,5-triphosphate (IP3) and diacylglycerol (DAG). These second messengers subsequently regulate various processes affecting cell growth, differentiation, and gene expression. This enzyme is regulated by small monomeric GTPases of the Ras and Rho families and by heterotrimeric G proteins. In addition to its phospholipase C catalytic activity, this enzyme has an N-terminal domain with guanine nucleotide exchange (GEF) activity. Mutations in this gene cause early-onset nephrotic syndrome; characterized by proteinuria, edema, and diffuse mesangial sclerosis or focal and segmental glomerulosclerosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mutation of this gene results in a congenital semilunar valvulogenesis defect which causes regurgitation and stenosis, and decreased incidence of induced skin tumors. Another mutant exhibits decreased cardiac contraction and increased hypertrophy in response to chronic stress. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	C	3: 138,065,476	L142P	probably benign	Het
Abca13	A	T	11: 9,291,126	R996S	possibly damaging	Het
Abcb6	A	G	1: 75,174,373	F558L	possibly damaging	Het
Acp7	T	A	7: 28,630,882	D2V	unknown	Het
Acvr1c	T	C	2: 58,284,936	D280G	probably damaging	Het
Atp8a1	A	G	5: 67,624,037	S1124P		Het
B4galnt1	A	T	10: 127,167,788	T207S	probably benign	Het
C2cd4d	C	A	3: 94,364,138	T237N	probably benign	Het
C8b	T	C	4: 104,780,627	C99R	probably damaging	Het
Ccnk	C	A	12: 108,193,705	Q149K	possibly damaging	Het
Chfr	A	G	5: 110,140,360	D47G	probably benign	Het
Chid1	A	T	7: 141,529,488		probably null	Het
Cmya5	T	A	13: 93,095,700	E960V	probably damaging	Het
Col18a1	A	G	10: 77,096,284	S112P	unknown	Het
Cps1	G	A	1: 67,170,921	V637I	probably damaging	Het
Crispld1	A	G	1: 17,752,878	T390A	probably benign	Het
Cyp2c54	A	T	19: 40,070,253	L245*	probably null	Het
Ddr2	G	T	1: 169,984,961	T654K	probably damaging	Het
Dnah10	T	C	5: 124,791,791		probably null	Het
Elavl4	C	T	4: 110,211,425		probably null	Het
Emilin1	T	C	5: 30,920,660	V921A	probably benign	Het
Evpl	T	A	11: 116,223,113	E1250D	probably damaging	Het
Fam228a	C	T	12: 4,732,790	G101E	probably benign	Het
Fam92b	T	A	8: 120,168,603	T187S	possibly damaging	Het
Gemin4	T	C	11: 76,212,106	T610A	probably damaging	Het
Glis1	T	C	4: 107,435,683	M1T	probably null	Het
Gm14399	C	T	2: 175,130,459		probably benign	Het
Gorasp2	C	T	2: 70,679,505	T170I	probably damaging	Het
Gpr37	A	G	6: 25,669,342	V501A	possibly damaging	Het
Grik4	T	A	9: 42,622,060	Q388L	probably benign	Het
Hspg2	T	A	4: 137,551,125	D3035E	probably damaging	Het
Htr4	A	T	18: 62,412,176	N11Y	probably benign	Het
Itgb2l	A	G	16: 96,429,043	S356P	probably damaging	Het
Klk1b22	A	G	7: 44,114,749	N34D	probably benign	Het
Lmcd1	A	G	6: 112,310,539	D62G	possibly damaging	Het
Lrp2	C	T	2: 69,486,352	G2095E	probably damaging	Het
Macf1	T	A	4: 123,440,743	E4407V	possibly damaging	Het
Mcm5	T	C	8: 75,124,859	F631L	probably benign	Het
Mov10l1	A	G	15: 88,993,868	S170G	probably benign	Het
Muc5b	A	T	7: 141,857,502	D1395V	unknown	Het
Muc6	G	A	7: 141,640,575	T1395M	probably benign	Het
Myh15	A	G	16: 49,091,105	D300G	probably damaging	Het
Nat6	T	C	9: 107,583,299	L131P	probably damaging	Het
Ndst4	A	G	3: 125,438,303	T174A	probably benign	Het
Nek5	T	A	8: 22,090,484	N406I	probably benign	Het
Nr2c2	G	A	6: 92,159,378	V400I	probably damaging	Het
Olfr364-ps1	G	T	2: 37,147,009	V266L	probably benign	Het
Olfr365	T	C	2: 37,202,080	Y280H	probably damaging	Het
Olfr449	G	A	6: 42,834,396		probably null	Het
Olfr554	T	C	7: 102,640,983	S246P	probably damaging	Het
Olfr612	A	T	7: 103,538,728	Y169N	probably benign	Het
Olfr787	T	A	10: 129,462,751	I25N	probably damaging	Het
Parn	T	C	16: 13,626,063		probably null	Het
Pfkl	T	C	10: 77,992,023	T468A	probably damaging	Het
Pi16	C	A	17: 29,319,234	P7Q	possibly damaging	Het
Prss16	A	T	13: 22,003,147	N442K	probably damaging	Het
Pus7	A	G	5: 23,752,344	S370P	probably damaging	Het
Ripk3	G	T	14: 55,787,284	Y210*	probably null	Het
Rps6ka2	C	A	17: 7,271,635	F317L	probably damaging	Het
Slc13a3	G	A	2: 165,445,528	R169W	possibly damaging	Het
Slc6a21	T	A	7: 45,282,480	I256N	possibly damaging	Het
Slc6a9	G	A	4: 117,868,106	R589Q	probably benign	Het
Slc8a2	T	C	7: 16,141,152	S442P	probably damaging	Het
Snupn	T	A	9: 56,982,744	M283K	probably damaging	Het
Steap3	A	T	1: 120,234,357	M395K	probably damaging	Het
Sv2b	G	A	7: 75,147,654	P331S	probably damaging	Het
Tlr1	A	G	5: 64,926,772	V154A	probably benign	Het
Tmem131	A	G	1: 36,796,301	S1580P	probably damaging	Het
Tmem51	TCCCC	TCCC	4: 142,037,685		probably null	Het
Trav14d-3-dv8	G	A	14: 53,078,761	R26H	probably benign	Het
Trp53	C	T	11: 69,591,255	L365F	probably benign	Het
Trp53bp1	A	T	2: 121,199,035	I1838N	probably damaging	Het
Ugt1a5	A	T	1: 88,166,886	K279*	probably null	Het
Unc80	A	G	1: 66,552,209	E1141G	possibly damaging	Het
Vti1b	T	C	12: 79,166,379	D49G	probably benign	Het
Wnt10a	A	T	1: 74,793,482	H78L	possibly damaging	Het
Zfp869	G	A	8: 69,706,478	H482Y	probably damaging	Het
Zfyve1	A	G	12: 83,551,540	V638A	probably damaging	Het

Other mutations in Plce1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Plce1	APN	19	38745788	missense	probably damaging	0.99
IGL00336:Plce1	APN	19	38651906	missense	probably damaging	1.00
IGL00430:Plce1	APN	19	38725017	missense	probably damaging	1.00
IGL00466:Plce1	APN	19	38721029	missense	probably damaging	0.99
IGL00477:Plce1	APN	19	38525132	missense	probably benign	0.39
IGL00839:Plce1	APN	19	38698562	missense	probably damaging	1.00
IGL01292:Plce1	APN	19	38651785	splice site	probably benign
IGL01665:Plce1	APN	19	38524887	missense	probably benign	0.01
IGL01826:Plce1	APN	19	38739238	splice site	probably benign
IGL01833:Plce1	APN	19	38720981	missense	probably damaging	1.00
IGL02201:Plce1	APN	19	38769446	splice site	probably benign
IGL02276:Plce1	APN	19	38524757	missense	probably benign	0.05
IGL02477:Plce1	APN	19	38719553	splice site	probably benign
IGL02746:Plce1	APN	19	38698472	missense	probably damaging	1.00
Angel_food	UTSW	19	38727013	splice site	probably benign
Heavenly	UTSW	19	38777989	missense	probably damaging	1.00
R0058:Plce1	UTSW	19	38525184	missense	possibly damaging	0.90
R0058:Plce1	UTSW	19	38525184	missense	possibly damaging	0.90
R0064:Plce1	UTSW	19	38780784	critical splice donor site	probably null
R0116:Plce1	UTSW	19	38721821	missense	probably benign
R0138:Plce1	UTSW	19	38524419	missense	possibly damaging	0.49
R0240:Plce1	UTSW	19	38728886	missense	probably damaging	0.99
R0240:Plce1	UTSW	19	38728886	missense	probably damaging	0.99
R0504:Plce1	UTSW	19	38778021	splice site	probably benign
R0506:Plce1	UTSW	19	38760138	missense	probably benign	0.04
R0578:Plce1	UTSW	19	38777939	missense	probably damaging	1.00
R0645:Plce1	UTSW	19	38777989	missense	probably damaging	1.00
R0730:Plce1	UTSW	19	38716691	missense	probably damaging	0.98
R0920:Plce1	UTSW	19	38736521	missense	probably damaging	1.00
R1223:Plce1	UTSW	19	38702013	missense	probably damaging	1.00
R1223:Plce1	UTSW	19	38767226	missense	probably damaging	1.00
R1484:Plce1	UTSW	19	38705339	nonsense	probably null
R1488:Plce1	UTSW	19	38716803	missense	possibly damaging	0.92
R1598:Plce1	UTSW	19	38720996	missense	probably damaging	1.00
R1624:Plce1	UTSW	19	38724775	missense	probably damaging	1.00
R1732:Plce1	UTSW	19	38716838	missense	possibly damaging	0.56
R1778:Plce1	UTSW	19	38780790	splice site	probably benign
R1797:Plce1	UTSW	19	38758948	critical splice donor site	probably null
R1872:Plce1	UTSW	19	38760077	missense	probably damaging	1.00
R1876:Plce1	UTSW	19	38780623	missense	probably damaging	1.00
R1991:Plce1	UTSW	19	38777924	missense	probably damaging	1.00
R2080:Plce1	UTSW	19	38727013	splice site	probably benign
R2103:Plce1	UTSW	19	38777924	missense	probably damaging	1.00
R2376:Plce1	UTSW	19	38777986	missense	probably benign	0.02
R2471:Plce1	UTSW	19	38779926	missense	probably damaging	1.00
R2511:Plce1	UTSW	19	38760054	missense	probably damaging	1.00
R2842:Plce1	UTSW	19	38524283	missense	probably damaging	1.00
R3037:Plce1	UTSW	19	38777884	missense	probably damaging	0.98
R3104:Plce1	UTSW	19	38620519	missense	probably benign	0.00
R3700:Plce1	UTSW	19	38705337	missense	probably damaging	1.00
R3750:Plce1	UTSW	19	38777899	missense	probably benign
R3753:Plce1	UTSW	19	38651834	missense	probably benign	0.09
R4027:Plce1	UTSW	19	38524265	missense	probably damaging	1.00
R4057:Plce1	UTSW	19	38760119	missense	probably damaging	1.00
R4376:Plce1	UTSW	19	38705447	critical splice donor site	probably null
R4433:Plce1	UTSW	19	38767301	missense	probably damaging	1.00
R4520:Plce1	UTSW	19	38524319	missense	possibly damaging	0.46
R4521:Plce1	UTSW	19	38524319	missense	possibly damaging	0.46
R4522:Plce1	UTSW	19	38524319	missense	possibly damaging	0.46
R4524:Plce1	UTSW	19	38524319	missense	possibly damaging	0.46
R4650:Plce1	UTSW	19	38524644	missense	probably benign	0.30
R4673:Plce1	UTSW	19	38749396	missense	possibly damaging	0.51
R4701:Plce1	UTSW	19	38725007	missense	probably benign	0.33
R4828:Plce1	UTSW	19	38769499	missense	probably damaging	1.00
R5103:Plce1	UTSW	19	38767215	missense	probably damaging	1.00
R5112:Plce1	UTSW	19	38651833	missense	probably benign	0.00
R5236:Plce1	UTSW	19	38770347	missense	probably benign	0.11
R5268:Plce1	UTSW	19	38758835	missense	possibly damaging	0.71
R5288:Plce1	UTSW	19	38760091	missense	probably damaging	1.00
R5384:Plce1	UTSW	19	38760091	missense	probably damaging	1.00
R5386:Plce1	UTSW	19	38760091	missense	probably damaging	1.00
R5448:Plce1	UTSW	19	38779917	missense	probably damaging	1.00
R5452:Plce1	UTSW	19	38620482	missense	probably benign	0.01
R6004:Plce1	UTSW	19	38721871	missense	probably damaging	1.00
R6062:Plce1	UTSW	19	38524751	missense	probably benign
R6147:Plce1	UTSW	19	38702037	missense	probably damaging	1.00
R6247:Plce1	UTSW	19	38745845	missense	probably damaging	1.00
R6278:Plce1	UTSW	19	38725051	splice site	probably null
R6306:Plce1	UTSW	19	38769465	missense	probably damaging	1.00
R6317:Plce1	UTSW	19	38524530	nonsense	probably null
R6437:Plce1	UTSW	19	38525132	missense	probably benign	0.39
R6522:Plce1	UTSW	19	38748521	splice site	probably null
R7034:Plce1	UTSW	19	38739357	missense	probably damaging	1.00
R7036:Plce1	UTSW	19	38739357	missense	probably damaging	1.00
R7037:Plce1	UTSW	19	38702017	missense	probably damaging	1.00
R7069:Plce1	UTSW	19	38758940	missense	probably damaging	1.00
R7180:Plce1	UTSW	19	38779785	missense	probably damaging	1.00
R7189:Plce1	UTSW	19	38760137	missense	probably damaging	0.97
R7227:Plce1	UTSW	19	38726902	missense	probably benign	0.00
R7253:Plce1	UTSW	19	38698508	missense	probably damaging	1.00
R7287:Plce1	UTSW	19	38701903	missense	probably benign	0.02
R7422:Plce1	UTSW	19	38651885	missense	probably damaging	1.00
R7557:Plce1	UTSW	19	38765404	missense	probably benign	0.30
R7607:Plce1	UTSW	19	38524752	missense	probably benign
R7615:Plce1	UTSW	19	38524665	missense	probably benign	0.18
R7653:Plce1	UTSW	19	38749319	missense	probably benign	0.20
R7685:Plce1	UTSW	19	38748433	missense	probably benign	0.00
R7716:Plce1	UTSW	19	38716851	missense	probably benign
R7744:Plce1	UTSW	19	38620455	missense	possibly damaging	0.93
R7790:Plce1	UTSW	19	38780696	missense	probably damaging	0.97
R7921:Plce1	UTSW	19	38620553	missense	probably benign	0.03
R8070:Plce1	UTSW	19	38701839	missense	probably damaging	0.99
R8087:Plce1	UTSW	19	38736521	missense	probably damaging	1.00
R8116:Plce1	UTSW	19	38524818	missense	probably benign	0.32
R8178:Plce1	UTSW	19	38772979	missense	possibly damaging	0.93
R8321:Plce1	UTSW	19	38651936	missense	probably benign	0.00
R8416:Plce1	UTSW	19	38772997	missense	possibly damaging	0.77
R8544:Plce1	UTSW	19	38524459	missense	probably benign	0.00
R8713:Plce1	UTSW	19	38524901	missense	probably benign	0.01
R8850:Plce1	UTSW	19	38524367	missense	probably benign
R9217:Plce1	UTSW	19	38760107	missense	probably damaging	1.00
R9231:Plce1	UTSW	19	38716596	missense	probably benign	0.13
R9232:Plce1	UTSW	19	38716979	missense	probably benign	0.16
R9332:Plce1	UTSW	19	38737933	missense	probably damaging	1.00
R9473:Plce1	UTSW	19	38777893	missense	possibly damaging	0.93
R9474:Plce1	UTSW	19	38777893	missense	possibly damaging	0.93
R9475:Plce1	UTSW	19	38777893	missense	possibly damaging	0.93
R9476:Plce1	UTSW	19	38777893	missense	possibly damaging	0.93
RF018:Plce1	UTSW	19	38717207	missense	probably damaging	0.99
X0022:Plce1	UTSW	19	38726999	missense	probably damaging	1.00
X0065:Plce1	UTSW	19	38777914	missense	possibly damaging	0.48
Z1176:Plce1	UTSW	19	38701894	missense	probably damaging	1.00
Z1176:Plce1	UTSW	19	38724980	nonsense	probably null
Z1176:Plce1	UTSW	19	38769460	missense	probably damaging	1.00
Z1177:Plce1	UTSW	19	38651842	missense	probably null	0.48

Predicted Primers

PCR Primer
(F):5'- CATTCATGGTGGATGCAAAGG -3'
(R):5'- ATAACTGCTTTCCAAGACCCG -3'

Sequencing Primer
(F):5'- AAAGGTGGCAGACATTTGGTTC -3'
(R):5'- GACCCGCTGACTAGGAACTTTC -3'

Posted On

2019-09-13