Incidental Mutation 'R7278:Cyp2c54'
ID 571585
Institutional Source Beutler Lab
Gene Symbol Cyp2c54
Ensembl Gene ENSMUSG00000067225
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 54
Synonyms
MMRRC Submission 045360-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.134) question?
Stock # R7278 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 40026384-40062271 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 40058697 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 245 (L245*)
Ref Sequence ENSEMBL: ENSMUSP00000048284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048959]
AlphaFold Q6XVG2
Predicted Effect probably null
Transcript: ENSMUST00000048959
AA Change: L245*
SMART Domains Protein: ENSMUSP00000048284
Gene: ENSMUSG00000067225
AA Change: L245*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:p450 30 487 2.2e-159 PFAM
Meta Mutation Damage Score 0.9568 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (78/79)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 137,771,237 (GRCm39) L142P probably benign Het
Abca13 A T 11: 9,241,126 (GRCm39) R996S possibly damaging Het
Abcb6 A G 1: 75,151,017 (GRCm39) F558L possibly damaging Het
Acp7 T A 7: 28,330,307 (GRCm39) D2V unknown Het
Acvr1c T C 2: 58,174,948 (GRCm39) D280G probably damaging Het
Atp8a1 A G 5: 67,781,380 (GRCm39) S1124P Het
B4galnt1 A T 10: 127,003,657 (GRCm39) T207S probably benign Het
C2cd4d C A 3: 94,271,445 (GRCm39) T237N probably benign Het
C8b T C 4: 104,637,824 (GRCm39) C99R probably damaging Het
Ccnk C A 12: 108,159,964 (GRCm39) Q149K possibly damaging Het
Chfr A G 5: 110,288,226 (GRCm39) D47G probably benign Het
Chid1 A T 7: 141,109,401 (GRCm39) probably null Het
Cibar2 T A 8: 120,895,342 (GRCm39) T187S possibly damaging Het
Cmya5 T A 13: 93,232,208 (GRCm39) E960V probably damaging Het
Col18a1 A G 10: 76,932,118 (GRCm39) S112P unknown Het
Cps1 G A 1: 67,210,080 (GRCm39) V637I probably damaging Het
Crispld1 A G 1: 17,823,102 (GRCm39) T390A probably benign Het
Ddr2 G T 1: 169,812,530 (GRCm39) T654K probably damaging Het
Dnah10 T C 5: 124,868,855 (GRCm39) probably null Het
Elavl4 C T 4: 110,068,622 (GRCm39) probably null Het
Emilin1 T C 5: 31,078,004 (GRCm39) V921A probably benign Het
Evpl T A 11: 116,113,939 (GRCm39) E1250D probably damaging Het
Fam228a C T 12: 4,782,790 (GRCm39) G101E probably benign Het
Gemin4 T C 11: 76,102,932 (GRCm39) T610A probably damaging Het
Glis1 T C 4: 107,292,880 (GRCm39) M1T probably null Het
Gm14399 C T 2: 174,972,252 (GRCm39) probably benign Het
Gorasp2 C T 2: 70,509,849 (GRCm39) T170I probably damaging Het
Gpr37 A G 6: 25,669,341 (GRCm39) V501A possibly damaging Het
Grik4 T A 9: 42,533,356 (GRCm39) Q388L probably benign Het
Hspg2 T A 4: 137,278,436 (GRCm39) D3035E probably damaging Het
Htr4 A T 18: 62,545,247 (GRCm39) N11Y probably benign Het
Itgb2l A G 16: 96,230,243 (GRCm39) S356P probably damaging Het
Klk1b22 A G 7: 43,764,173 (GRCm39) N34D probably benign Het
Lmcd1 A G 6: 112,287,500 (GRCm39) D62G possibly damaging Het
Lrp2 C T 2: 69,316,696 (GRCm39) G2095E probably damaging Het
Macf1 T A 4: 123,334,536 (GRCm39) E4407V possibly damaging Het
Mcm5 T C 8: 75,851,487 (GRCm39) F631L probably benign Het
Mov10l1 A G 15: 88,878,071 (GRCm39) S170G probably benign Het
Muc5b A T 7: 141,411,239 (GRCm39) D1395V unknown Het
Muc6 G A 7: 141,226,842 (GRCm39) T1395M probably benign Het
Myh15 A G 16: 48,911,468 (GRCm39) D300G probably damaging Het
Naa80 T C 9: 107,460,498 (GRCm39) L131P probably damaging Het
Ndst4 A G 3: 125,231,952 (GRCm39) T174A probably benign Het
Nek5 T A 8: 22,580,500 (GRCm39) N406I probably benign Het
Nr2c2 G A 6: 92,136,359 (GRCm39) V400I probably damaging Het
Or1l4 T C 2: 37,092,092 (GRCm39) Y280H probably damaging Het
Or1l4b G T 2: 37,037,021 (GRCm39) V266L probably benign Het
Or51aa2 A T 7: 103,187,935 (GRCm39) Y169N probably benign Het
Or52m1 T C 7: 102,290,190 (GRCm39) S246P probably damaging Het
Or6b1 G A 6: 42,811,330 (GRCm39) probably null Het
Or6c5c T A 10: 129,298,620 (GRCm39) I25N probably damaging Het
Parn T C 16: 13,443,927 (GRCm39) probably null Het
Pfkl T C 10: 77,827,857 (GRCm39) T468A probably damaging Het
Pi16 C A 17: 29,538,208 (GRCm39) P7Q possibly damaging Het
Plce1 T C 19: 38,768,340 (GRCm39) I2205T possibly damaging Het
Prss16 A T 13: 22,187,317 (GRCm39) N442K probably damaging Het
Pus7 A G 5: 23,957,342 (GRCm39) S370P probably damaging Het
Ripk3 G T 14: 56,024,741 (GRCm39) Y210* probably null Het
Rps6ka2 C A 17: 7,539,034 (GRCm39) F317L probably damaging Het
Slc13a3 G A 2: 165,287,448 (GRCm39) R169W possibly damaging Het
Slc6a21 T A 7: 44,931,904 (GRCm39) I256N possibly damaging Het
Slc6a9 G A 4: 117,725,303 (GRCm39) R589Q probably benign Het
Slc8a2 T C 7: 15,875,077 (GRCm39) S442P probably damaging Het
Snupn T A 9: 56,890,028 (GRCm39) M283K probably damaging Het
Steap3 A T 1: 120,162,087 (GRCm39) M395K probably damaging Het
Sv2b G A 7: 74,797,402 (GRCm39) P331S probably damaging Het
Tlr1 A G 5: 65,084,115 (GRCm39) V154A probably benign Het
Tmem131 A G 1: 36,835,382 (GRCm39) S1580P probably damaging Het
Tmem51 TCCCC TCCC 4: 141,764,996 (GRCm39) probably null Het
Trav14d-3-dv8 G A 14: 53,316,218 (GRCm39) R26H probably benign Het
Trp53 C T 11: 69,482,081 (GRCm39) L365F probably benign Het
Trp53bp1 A T 2: 121,029,516 (GRCm39) I1838N probably damaging Het
Ugt1a5 A T 1: 88,094,608 (GRCm39) K279* probably null Het
Unc80 A G 1: 66,591,368 (GRCm39) E1141G possibly damaging Het
Vti1b T C 12: 79,213,153 (GRCm39) D49G probably benign Het
Wnt10a A T 1: 74,832,641 (GRCm39) H78L possibly damaging Het
Zfp869 G A 8: 70,159,128 (GRCm39) H482Y probably damaging Het
Zfyve1 A G 12: 83,598,314 (GRCm39) V638A probably damaging Het
Other mutations in Cyp2c54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Cyp2c54 APN 19 40,060,522 (GRCm39) missense probably damaging 1.00
IGL02694:Cyp2c54 APN 19 40,035,987 (GRCm39) missense possibly damaging 0.55
IGL03170:Cyp2c54 APN 19 40,060,809 (GRCm39) critical splice donor site probably null
IGL03175:Cyp2c54 APN 19 40,058,672 (GRCm39) missense probably benign 0.00
R0097:Cyp2c54 UTSW 19 40,036,103 (GRCm39) splice site probably benign
R0097:Cyp2c54 UTSW 19 40,036,102 (GRCm39) splice site probably benign
R0391:Cyp2c54 UTSW 19 40,060,613 (GRCm39) missense possibly damaging 0.61
R0581:Cyp2c54 UTSW 19 40,035,999 (GRCm39) missense probably benign 0.23
R0787:Cyp2c54 UTSW 19 40,036,079 (GRCm39) missense probably benign 0.12
R1253:Cyp2c54 UTSW 19 40,034,629 (GRCm39) missense probably damaging 1.00
R1481:Cyp2c54 UTSW 19 40,036,032 (GRCm39) missense probably benign 0.30
R1604:Cyp2c54 UTSW 19 40,058,787 (GRCm39) missense probably benign 0.01
R3624:Cyp2c54 UTSW 19 40,058,688 (GRCm39) missense probably benign 0.21
R3871:Cyp2c54 UTSW 19 40,060,867 (GRCm39) missense probably benign 0.37
R3983:Cyp2c54 UTSW 19 40,034,699 (GRCm39) missense possibly damaging 0.49
R4401:Cyp2c54 UTSW 19 40,060,615 (GRCm39) missense probably benign 0.04
R4416:Cyp2c54 UTSW 19 40,026,703 (GRCm39) missense probably benign 0.04
R4962:Cyp2c54 UTSW 19 40,060,585 (GRCm39) missense possibly damaging 0.90
R5203:Cyp2c54 UTSW 19 40,060,918 (GRCm39) missense probably damaging 1.00
R5634:Cyp2c54 UTSW 19 40,060,858 (GRCm39) missense possibly damaging 0.84
R6083:Cyp2c54 UTSW 19 40,062,206 (GRCm39) missense probably benign 0.20
R6182:Cyp2c54 UTSW 19 40,036,005 (GRCm39) missense probably benign
R6754:Cyp2c54 UTSW 19 40,060,004 (GRCm39) missense probably damaging 1.00
R6901:Cyp2c54 UTSW 19 40,058,703 (GRCm39) missense probably damaging 1.00
R6948:Cyp2c54 UTSW 19 40,034,636 (GRCm39) missense possibly damaging 0.73
R7215:Cyp2c54 UTSW 19 40,034,626 (GRCm39) missense probably damaging 1.00
R7244:Cyp2c54 UTSW 19 40,035,953 (GRCm39) missense probably damaging 1.00
R7535:Cyp2c54 UTSW 19 40,058,716 (GRCm39) missense probably benign
R7838:Cyp2c54 UTSW 19 40,058,688 (GRCm39) missense probably benign 0.21
R8039:Cyp2c54 UTSW 19 40,062,176 (GRCm39) frame shift probably null
R8275:Cyp2c54 UTSW 19 40,026,749 (GRCm39) missense probably benign 0.00
R8340:Cyp2c54 UTSW 19 40,060,831 (GRCm39) missense possibly damaging 0.94
R8367:Cyp2c54 UTSW 19 40,062,125 (GRCm39) missense probably damaging 0.99
R8477:Cyp2c54 UTSW 19 40,058,708 (GRCm39) missense probably benign 0.43
R8487:Cyp2c54 UTSW 19 40,059,990 (GRCm39) missense probably damaging 1.00
R8519:Cyp2c54 UTSW 19 40,026,857 (GRCm39) missense probably damaging 0.99
R8534:Cyp2c54 UTSW 19 40,036,030 (GRCm39) missense probably damaging 0.99
R8858:Cyp2c54 UTSW 19 40,062,227 (GRCm39) missense probably benign 0.00
R9215:Cyp2c54 UTSW 19 40,035,950 (GRCm39) missense possibly damaging 0.52
R9236:Cyp2c54 UTSW 19 40,060,938 (GRCm39) nonsense probably null
R9470:Cyp2c54 UTSW 19 40,060,888 (GRCm39) missense probably damaging 1.00
R9792:Cyp2c54 UTSW 19 40,034,525 (GRCm39) missense probably damaging 1.00
Z1176:Cyp2c54 UTSW 19 40,034,659 (GRCm39) missense probably damaging 1.00
Z1177:Cyp2c54 UTSW 19 40,062,201 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGTGGCGTTTCTACTCACAAG -3'
(R):5'- CATTTGGGTAGTAATTTCTCCCTTG -3'

Sequencing Primer
(F):5'- ATTGTTTTTCACATGGTATTGTCATG -3'
(R):5'- GGGTAGTAATTTCTCCCTTGTATTTC -3'
Posted On 2019-09-13