Mutagenetix > Incidental Mutations

Incidental Mutation 'R7296:Ptpn1'

571604

Institutional Source

Beutler Lab

Gene Symbol

Ptpn1

Ensembl Gene

ENSMUSG00000027540

Gene Name

protein tyrosine phosphatase, non-receptor type 1

Synonyms

PTP-1B, PTP1B

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.907) question?

Stock #

R7296 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

167932057-167979385 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 167974772 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 249 (V249A)

Ref Sequence

ENSEMBL: ENSMUSP00000029053 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029053]

Predicted Effect

probably damaging
Transcript: ENSMUST00000029053
AA Change: V249A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000029053
Gene: ENSMUSG00000027540
AA Change: V249A

Domain	Start	End	E-Value	Type
PTPc	15	279	1.35e-123	SMART
low complexity region	301	320	N/A	INTRINSIC
low complexity region	354	364	N/A	INTRINSIC
low complexity region	387	397	N/A	INTRINSIC
transmembrane domain	409	431	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.8%

Validation Efficiency

98% (85/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the founding member of the protein tyrosine phosphatase (PTP) family, which was isolated and identified based on its enzymatic activity and amino acid sequence. PTPs catalyze the hydrolysis of the phosphate monoesters specifically on tyrosine residues. Members of the PTP family share a highly conserved catalytic motif, which is essential for the catalytic activity. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP has been shown to act as a negative regulator of insulin signaling by dephosphorylating the phosphotryosine residues of insulin receptor kinase. This PTP was also reported to dephosphorylate epidermal growth factor receptor kinase, as well as JAK2 and TYK2 kinases, which implicated the role of this PTP in cell growth control, and cell response to interferon stimulation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit greatly reduced adiposity due to reduced fat cell mass, increased basal metabolic rate, mild hypoglycemia and hypoinsulinemia, increased insulin sensitivity, and enhanced sensitivity to leptin. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700066M21Rik	T	A	1: 57,383,143	M226K	probably benign	Het
2010300C02Rik	T	C	1: 37,614,618	T1036A	possibly damaging	Het
4921524L21Rik	T	G	18: 6,626,385	S132R	probably damaging	Het
A4gnt	T	G	9: 99,620,282	I165S	probably damaging	Het
Abca14	G	A	7: 120,278,311	D1061N	probably benign	Het
Abcc9	G	A	6: 142,671,593	P582S	probably damaging	Het
Abhd5	G	A	9: 122,379,573	V343I	probably benign	Het
Adam6a	C	T	12: 113,545,572	R522C	probably damaging	Het
Ankle2	G	A	5: 110,237,724	R313H	probably damaging	Het
Aplf	G	A	6: 87,646,215	T315I	probably damaging	Het
Arntl2	G	A	6: 146,822,134	V321I	not run	Het
Asic5	C	T	3: 82,021,076	P491S	probably benign	Het
Atp5b	T	C	10: 128,085,522	Y230H	probably benign	Het
B4galt6	A	T	18: 20,728,042	I51N	probably damaging	Het
C4b	A	G	17: 34,743,659	L23S	probably damaging	Het
C77080	A	G	4: 129,225,418	Y170H	probably damaging	Het
Cables2	A	G	2: 180,260,336	V410A		Het
Cdyl	A	G	13: 35,863,395	M489V	probably damaging	Het
Clip4	T	C	17: 71,790,001	M40T	probably damaging	Het
Col12a1	T	C	9: 79,682,066	Y1069C	probably damaging	Het
Col6a3	T	C	1: 90,827,986	M194V	probably benign	Het
Colec11	T	A	12: 28,594,715	D260V	probably damaging	Het
Cux2	T	C	5: 121,861,256	D1207G	probably benign	Het
Cyp2d34	G	T	15: 82,617,235	N297K	possibly damaging	Het
Dmbt1	A	G	7: 131,112,132	Y1643C	unknown	Het
Dnmt3c	A	G	2: 153,715,026	T288A	probably benign	Het
Dock8	T	A	19: 25,184,881	F1842I	probably benign	Het
Dysf	A	G	6: 84,106,898	I740V	probably benign	Het
Epha6	T	A	16: 59,915,838	M778L	probably benign	Het
Eri2	A	T	7: 119,786,516	L254*	probably null	Het
Fam129b	T	C	2: 32,922,642	S468P	possibly damaging	Het
Fam43b	A	G	4: 138,395,841	F56S	probably damaging	Het
Fat4	C	A	3: 38,889,145	S729*	probably null	Het
Fbxw22	C	A	9: 109,382,075	W386L	probably benign	Het
Fgd6	T	A	10: 94,044,047	C254*	probably null	Het
Fgd6	C	A	10: 94,139,881	T1386K	probably benign	Het
Fkbp7	G	T	2: 76,671,764	D98E	possibly damaging	Het
Gm8251	T	A	1: 44,060,916	K341*	probably null	Het
Hectd1	C	T	12: 51,785,852	C913Y	possibly damaging	Het
Hgf	T	A	5: 16,564,843	M105K	probably benign	Het
Icam1	A	C	9: 21,019,015	D55A	probably benign	Het
Itga2	A	C	13: 114,857,394		probably null	Het
Kcnj5	A	C	9: 32,322,749	L90R	probably damaging	Het
Klra17	T	A	6: 129,831,592	N226I	possibly damaging	Het
Krt1	T	A	15: 101,850,629	R33S	unknown	Het
L3mbtl3	T	A	10: 26,282,830	D615V	unknown	Het
Lrp2	T	A	2: 69,482,381	Y2521F	probably benign	Het
Megf10	A	T	18: 57,275,753	N589I	probably damaging	Het
Metap1d	G	C	2: 71,506,785	G14A	probably benign	Het
Mfap5	T	A	6: 122,528,422	D162E	probably benign	Het
Mixl1	T	C	1: 180,696,958	I19V	probably benign	Het
Mtrr	G	T	13: 68,568,860	Y411*	probably null	Het
Myh7	T	C	14: 54,990,025	T318A	probably benign	Het
Nbeal1	T	A	1: 60,310,224	Y2348*	probably null	Het
Nlrc3	T	C	16: 3,963,590	S668G	probably damaging	Het
Nutm1	G	A	2: 112,250,056	R505C	probably damaging	Het
Olfr1129	T	A	2: 87,575,708	V208E	probably damaging	Het
Olfr1222	C	A	2: 89,124,836	R298S	probably benign	Het
Olfr527	A	T	7: 140,336,741	D293V	possibly damaging	Het
Pcna	A	G	2: 132,252,877	S54P	probably benign	Het
Pde6a	A	G	18: 61,258,293	T570A	probably damaging	Het
Phf21b	A	T	15: 84,855,717	M1K	probably null	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Prob1	A	G	18: 35,653,299	F634S	possibly damaging	Het
Prss50	A	G	9: 110,861,289	T167A	probably damaging	Het
Rai1	G	A	11: 60,188,673	V1188I	probably benign	Het
Ric1	G	A	19: 29,584,578		probably null	Het
Robo1	C	T	16: 72,989,631	Q844*	probably null	Het
Rpn1	A	G	6: 88,084,637	D36G	possibly damaging	Het
Serpinb1b	A	T	13: 33,093,827	M348L	probably benign	Het
Setd4	T	C	16: 93,583,942		probably null	Het
Setd5	T	G	6: 113,147,557	S1124A	probably benign	Het
Slc35c1	C	A	2: 92,458,739	V154F	probably damaging	Het
Slc7a6os	G	T	8: 106,210,489	S113*	probably null	Het
Syne2	T	A	12: 76,103,036	D1787E	probably benign	Het
Tas2r144	A	C	6: 42,215,439	I38L	probably damaging	Het
Tepsin	G	T	11: 120,091,708	T512K	possibly damaging	Het
Utp20	A	G	10: 88,770,724	V1662A	probably benign	Het
Vmn1r201	C	T	13: 22,475,339	A241V	possibly damaging	Het
Vmn2r60	T	A	7: 42,136,402	S210T	probably benign	Het
Wdr6	G	T	9: 108,574,585	H700N	probably damaging	Het
Zdhhc8	T	C	16: 18,234,926	T29A	probably benign	Het
Zfp335	A	G	2: 164,900,132	I614T	probably damaging	Het
Zfp54	T	A	17: 21,433,582	S113T	probably benign	Het
Zfp873	T	A	10: 82,061,237	C601S	probably damaging	Het
Zfyve26	T	C	12: 79,278,372		probably null	Het
Zmynd8	T	C	2: 165,840,009	T201A	probably damaging	Het

Other mutations in Ptpn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01482:Ptpn1	APN	2	167967792	missense	probably damaging	1.00
IGL02976:Ptpn1	APN	2	167971784	missense	probably benign	0.01
R0106:Ptpn1	UTSW	2	167976418	unclassified	probably benign
R0106:Ptpn1	UTSW	2	167976418	unclassified	probably benign
R1438:Ptpn1	UTSW	2	167976609	missense	probably damaging	0.99
R3010:Ptpn1	UTSW	2	167974822	missense	probably damaging	1.00
R3607:Ptpn1	UTSW	2	167975507	missense	probably benign
R3755:Ptpn1	UTSW	2	167974223	missense	probably damaging	1.00
R4075:Ptpn1	UTSW	2	167976513	unclassified	probably null
R4160:Ptpn1	UTSW	2	167967811	missense	probably benign	0.04
R4627:Ptpn1	UTSW	2	167967781	missense	probably benign	0.00
R4754:Ptpn1	UTSW	2	167974160	missense	probably damaging	1.00
R5596:Ptpn1	UTSW	2	167974763	missense	probably damaging	1.00
R5920:Ptpn1	UTSW	2	167971748	missense	probably benign	0.02
R6133:Ptpn1	UTSW	2	167967796	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- GTACGCTAAGACATCCACGG -3'
(R):5'- GCTAGGAACAGAGCTGAACACC -3'

Sequencing Primer
(F):5'- GCTAAGACATCCACGGGGTAC -3'
(R):5'- CACCAACATGTATTCTTGAAGCAGAG -3'

Posted On

2019-09-13