Incidental Mutation 'R7296:Hgf'
ID 571610
Institutional Source Beutler Lab
Gene Symbol Hgf
Ensembl Gene ENSMUSG00000028864
Gene Name hepatocyte growth factor
Synonyms HGF/SF, NK1, C230052L06Rik, scatter factor, NK2, SF/HGF
MMRRC Submission 045400-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7296 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 16553495-16620152 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 16564843 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 105 (M105K)
Ref Sequence ENSEMBL: ENSMUSP00000030683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030683] [ENSMUST00000196645] [ENSMUST00000199581]
AlphaFold Q08048
PDB Structure A Mechanistic Basis for Converting a Receptor Tyrosine Kinase Agonist to an Antagonist [X-RAY DIFFRACTION]
Crystal structure of the N-terminal fragment (31-127) of the mouse hepatocyte growth factor/scatter factor [X-RAY DIFFRACTION]
Crystal Structure of the NK2 Fragment (31-290) of the mouse Hepatocyte Growth Factor/Scatter Factor [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000030683
AA Change: M105K

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030683
Gene: ENSMUSG00000028864
AA Change: M105K

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
PAN_AP 38 123 6.47e-13 SMART
KR 127 209 3.03e-46 SMART
KR 210 291 9.04e-45 SMART
KR 304 386 7.35e-45 SMART
KR 390 472 1.02e-38 SMART
Tryp_SPc 495 719 5.6e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196645
AA Change: M105K

PolyPhen 2 Score 0.341 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142517
Gene: ENSMUSG00000028864
AA Change: M105K

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
PAN_AP 38 123 6.47e-13 SMART
KR 127 204 3.76e-42 SMART
KR 205 286 9.04e-45 SMART
KR 299 381 7.35e-45 SMART
KR 385 467 1.02e-38 SMART
Tryp_SPc 490 714 5.6e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199581
AA Change: M105K

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143424
Gene: ENSMUSG00000028864
AA Change: M105K

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
PAN_AP 38 123 6.47e-13 SMART
KR 127 209 3.03e-46 SMART
KR 210 291 9.04e-45 SMART
KR 304 386 7.35e-45 SMART
KR 390 472 1.02e-38 SMART
Tryp_SPc 495 719 5.6e-55 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: This gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the hepatocyte growth factor alpha and beta chains, which heterodimerize to form the mature active protein. Although this protein is a member of the peptidase S1 family of serine proteases, it lacks peptidase activity. Homozygous knockout mice for this gene exhibit embryonic lethality due to impaired development of the placenta and liver. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced embryonic livers, impaired migration of dermomyotome precursors affecting skeletal muscle formation, defective navigation of hypoglossal motor axons, abnormal placentas, and prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik T A 1: 57,383,143 (GRCm38) M226K probably benign Het
4921524L21Rik T G 18: 6,626,385 (GRCm38) S132R probably damaging Het
A4gnt T G 9: 99,620,282 (GRCm38) I165S probably damaging Het
Abca14 G A 7: 120,278,311 (GRCm38) D1061N probably benign Het
Abcc9 G A 6: 142,671,593 (GRCm38) P582S probably damaging Het
Abhd5 G A 9: 122,379,573 (GRCm38) V343I probably benign Het
Adam6a C T 12: 113,545,572 (GRCm38) R522C probably damaging Het
Ankle2 G A 5: 110,237,724 (GRCm38) R313H probably damaging Het
Aplf G A 6: 87,646,215 (GRCm38) T315I probably damaging Het
Asic5 C T 3: 82,021,076 (GRCm38) P491S probably benign Het
Atp5f1b T C 10: 128,085,522 (GRCm38) Y230H probably benign Het
B4galt6 A T 18: 20,728,042 (GRCm38) I51N probably damaging Het
Bmal2 G A 6: 146,822,134 (GRCm38) V321I not run Het
C4b A G 17: 34,743,659 (GRCm38) L23S probably damaging Het
Cables2 A G 2: 180,260,336 (GRCm38) V410A Het
Ccdc168 T A 1: 44,060,916 (GRCm38) K341* probably null Het
Cdyl A G 13: 35,863,395 (GRCm38) M489V probably damaging Het
Clip4 T C 17: 71,790,001 (GRCm38) M40T probably damaging Het
Col12a1 T C 9: 79,682,066 (GRCm38) Y1069C probably damaging Het
Col6a3 T C 1: 90,827,986 (GRCm38) M194V probably benign Het
Colec11 T A 12: 28,594,715 (GRCm38) D260V probably damaging Het
Cracdl T C 1: 37,614,618 (GRCm38) T1036A possibly damaging Het
Cux2 T C 5: 121,861,256 (GRCm38) D1207G probably benign Het
Cyp2d34 G T 15: 82,617,235 (GRCm38) N297K possibly damaging Het
Dmbt1 A G 7: 131,112,132 (GRCm38) Y1643C unknown Het
Dnmt3c A G 2: 153,715,026 (GRCm38) T288A probably benign Het
Dock8 T A 19: 25,184,881 (GRCm38) F1842I probably benign Het
Dysf A G 6: 84,106,898 (GRCm38) I740V probably benign Het
Epha6 T A 16: 59,915,838 (GRCm38) M778L probably benign Het
Eri2 A T 7: 119,786,516 (GRCm38) L254* probably null Het
Fam43b A G 4: 138,395,841 (GRCm38) F56S probably damaging Het
Fat4 C A 3: 38,889,145 (GRCm38) S729* probably null Het
Fbxw22 C A 9: 109,382,075 (GRCm38) W386L probably benign Het
Fgd6 C A 10: 94,139,881 (GRCm38) T1386K probably benign Het
Fgd6 T A 10: 94,044,047 (GRCm38) C254* probably null Het
Fkbp7 G T 2: 76,671,764 (GRCm38) D98E possibly damaging Het
Hectd1 C T 12: 51,785,852 (GRCm38) C913Y possibly damaging Het
Icam1 A C 9: 21,019,015 (GRCm38) D55A probably benign Het
Itga2 A C 13: 114,857,394 (GRCm38) probably null Het
Kcnj5 A C 9: 32,322,749 (GRCm38) L90R probably damaging Het
Klra17 T A 6: 129,831,592 (GRCm38) N226I possibly damaging Het
Krt1 T A 15: 101,850,629 (GRCm38) R33S unknown Het
L3mbtl3 T A 10: 26,282,830 (GRCm38) D615V unknown Het
Lrp2 T A 2: 69,482,381 (GRCm38) Y2521F probably benign Het
Megf10 A T 18: 57,275,753 (GRCm38) N589I probably damaging Het
Metap1d G C 2: 71,506,785 (GRCm38) G14A probably benign Het
Mfap5 T A 6: 122,528,422 (GRCm38) D162E probably benign Het
Mixl1 T C 1: 180,696,958 (GRCm38) I19V probably benign Het
Mtrr G T 13: 68,568,860 (GRCm38) Y411* probably null Het
Myh7 T C 14: 54,990,025 (GRCm38) T318A probably benign Het
Nbeal1 T A 1: 60,310,224 (GRCm38) Y2348* probably null Het
Nhsl3 A G 4: 129,225,418 (GRCm38) Y170H probably damaging Het
Niban2 T C 2: 32,922,642 (GRCm38) S468P possibly damaging Het
Nlrc3 T C 16: 3,963,590 (GRCm38) S668G probably damaging Het
Nutm1 G A 2: 112,250,056 (GRCm38) R505C probably damaging Het
Or10ag59 T A 2: 87,575,708 (GRCm38) V208E probably damaging Het
Or12j2 A T 7: 140,336,741 (GRCm38) D293V possibly damaging Het
Or4c117 C A 2: 89,124,836 (GRCm38) R298S probably benign Het
Pcna A G 2: 132,252,877 (GRCm38) S54P probably benign Het
Pde6a A G 18: 61,258,293 (GRCm38) T570A probably damaging Het
Phf21b A T 15: 84,855,717 (GRCm38) M1K probably null Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 (GRCm38) probably benign Het
Prob1 A G 18: 35,653,299 (GRCm38) F634S possibly damaging Het
Prss50 A G 9: 110,861,289 (GRCm38) T167A probably damaging Het
Ptpn1 T C 2: 167,974,772 (GRCm38) V249A probably damaging Het
Rai1 G A 11: 60,188,673 (GRCm38) V1188I probably benign Het
Ric1 G A 19: 29,584,578 (GRCm38) probably null Het
Robo1 C T 16: 72,989,631 (GRCm38) Q844* probably null Het
Rpn1 A G 6: 88,084,637 (GRCm38) D36G possibly damaging Het
Serpinb1b A T 13: 33,093,827 (GRCm38) M348L probably benign Het
Setd4 T C 16: 93,583,942 (GRCm38) probably null Het
Setd5 T G 6: 113,147,557 (GRCm38) S1124A probably benign Het
Slc35c1 C A 2: 92,458,739 (GRCm38) V154F probably damaging Het
Slc7a6os G T 8: 106,210,489 (GRCm38) S113* probably null Het
Syne2 T A 12: 76,103,036 (GRCm38) D1787E probably benign Het
Tas2r144 A C 6: 42,215,439 (GRCm38) I38L probably damaging Het
Tepsin G T 11: 120,091,708 (GRCm38) T512K possibly damaging Het
Utp20 A G 10: 88,770,724 (GRCm38) V1662A probably benign Het
Vmn1r201 C T 13: 22,475,339 (GRCm38) A241V possibly damaging Het
Vmn2r60 T A 7: 42,136,402 (GRCm38) S210T probably benign Het
Wdr6 G T 9: 108,574,585 (GRCm38) H700N probably damaging Het
Zdhhc8 T C 16: 18,234,926 (GRCm38) T29A probably benign Het
Zfp335 A G 2: 164,900,132 (GRCm38) I614T probably damaging Het
Zfp54 T A 17: 21,433,582 (GRCm38) S113T probably benign Het
Zfp873 T A 10: 82,061,237 (GRCm38) C601S probably damaging Het
Zfyve26 T C 12: 79,278,372 (GRCm38) probably null Het
Zmynd8 T C 2: 165,840,009 (GRCm38) T201A probably damaging Het
Other mutations in Hgf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Hgf APN 5 16,611,882 (GRCm38) missense possibly damaging 0.70
IGL00427:Hgf APN 5 16,578,486 (GRCm38) missense probably benign 0.09
IGL00788:Hgf APN 5 16,598,230 (GRCm38) missense probably damaging 0.99
IGL01290:Hgf APN 5 16,604,846 (GRCm38) missense probably damaging 1.00
IGL01333:Hgf APN 5 16,576,941 (GRCm38) nonsense probably null
IGL01568:Hgf APN 5 16,564,814 (GRCm38) missense probably damaging 1.00
IGL02314:Hgf APN 5 16,572,602 (GRCm38) missense probably damaging 0.99
IGL02328:Hgf APN 5 16,598,221 (GRCm38) missense probably damaging 1.00
IGL02368:Hgf APN 5 16,564,794 (GRCm38) missense possibly damaging 0.95
IGL02486:Hgf APN 5 16,602,289 (GRCm38) missense probably damaging 1.00
IGL02654:Hgf APN 5 16,561,051 (GRCm38) missense probably benign
Foiegras UTSW 5 16,615,802 (GRCm38) missense probably benign 0.01
PIT4378001:Hgf UTSW 5 16,611,862 (GRCm38) missense probably damaging 1.00
R0708:Hgf UTSW 5 16,566,763 (GRCm38) nonsense probably null
R0710:Hgf UTSW 5 16,566,763 (GRCm38) nonsense probably null
R0718:Hgf UTSW 5 16,593,859 (GRCm38) missense probably damaging 1.00
R0967:Hgf UTSW 5 16,593,841 (GRCm38) splice site probably benign
R1181:Hgf UTSW 5 16,618,925 (GRCm38) missense probably damaging 1.00
R1589:Hgf UTSW 5 16,613,785 (GRCm38) missense probably damaging 1.00
R1705:Hgf UTSW 5 16,615,802 (GRCm38) missense probably benign 0.01
R1983:Hgf UTSW 5 16,561,012 (GRCm38) missense possibly damaging 0.53
R2021:Hgf UTSW 5 16,576,921 (GRCm38) missense probably benign
R2441:Hgf UTSW 5 16,604,790 (GRCm38) missense probably damaging 0.99
R4083:Hgf UTSW 5 16,615,858 (GRCm38) nonsense probably null
R4084:Hgf UTSW 5 16,615,858 (GRCm38) nonsense probably null
R4211:Hgf UTSW 5 16,614,993 (GRCm38) missense probably damaging 0.99
R4388:Hgf UTSW 5 16,614,943 (GRCm38) missense probably benign 0.12
R4394:Hgf UTSW 5 16,618,951 (GRCm38) nonsense probably null
R4575:Hgf UTSW 5 16,572,601 (GRCm38) missense probably benign
R5044:Hgf UTSW 5 16,614,894 (GRCm38) missense probably benign 0.00
R5319:Hgf UTSW 5 16,566,862 (GRCm38) critical splice donor site probably null
R5585:Hgf UTSW 5 16,564,801 (GRCm38) missense possibly damaging 0.93
R5700:Hgf UTSW 5 16,610,124 (GRCm38) missense probably damaging 1.00
R5814:Hgf UTSW 5 16,602,307 (GRCm38) missense probably benign 0.19
R6125:Hgf UTSW 5 16,598,161 (GRCm38) missense probably damaging 1.00
R6749:Hgf UTSW 5 16,613,642 (GRCm38) splice site probably null
R6891:Hgf UTSW 5 16,604,922 (GRCm38) critical splice donor site probably null
R6962:Hgf UTSW 5 16,615,754 (GRCm38) missense probably benign 0.32
R7251:Hgf UTSW 5 16,593,944 (GRCm38) missense possibly damaging 0.95
R7463:Hgf UTSW 5 16,578,450 (GRCm38) missense probably benign 0.00
R7470:Hgf UTSW 5 16,618,856 (GRCm38) missense probably benign 0.02
R7630:Hgf UTSW 5 16,598,250 (GRCm38) missense probably benign 0.01
R7807:Hgf UTSW 5 16,577,011 (GRCm38) missense probably damaging 0.99
R8098:Hgf UTSW 5 16,561,061 (GRCm38) missense probably benign 0.04
R8120:Hgf UTSW 5 16,613,781 (GRCm38) missense probably damaging 1.00
R8132:Hgf UTSW 5 16,602,331 (GRCm38) missense probably damaging 1.00
R8499:Hgf UTSW 5 16,566,856 (GRCm38) missense probably damaging 0.99
R8929:Hgf UTSW 5 16,593,990 (GRCm38) missense probably benign 0.44
R9016:Hgf UTSW 5 16,618,958 (GRCm38) missense probably damaging 1.00
R9126:Hgf UTSW 5 16,560,981 (GRCm38) missense possibly damaging 0.95
R9197:Hgf UTSW 5 16,561,061 (GRCm38) missense probably benign 0.04
R9347:Hgf UTSW 5 16,604,923 (GRCm38) critical splice donor site probably null
R9478:Hgf UTSW 5 16,561,031 (GRCm38) missense possibly damaging 0.70
R9696:Hgf UTSW 5 16,572,536 (GRCm38) missense probably damaging 1.00
R9729:Hgf UTSW 5 16,561,031 (GRCm38) missense probably damaging 0.97
R9732:Hgf UTSW 5 16,615,750 (GRCm38) missense probably damaging 1.00
X0024:Hgf UTSW 5 16,604,828 (GRCm38) missense probably damaging 1.00
Z1088:Hgf UTSW 5 16,618,919 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCACAGAGTCTTGATCTCG -3'
(R):5'- GTGGCACAAATCAGAATCTGAC -3'

Sequencing Primer
(F):5'- TGCTCCTTTGAAATAGGACACAC -3'
(R):5'- TCAGAATCTGACCAAAACATCCACAG -3'
Posted On 2019-09-13