Incidental Mutation 'R7296:Hgf'
ID571610
Institutional Source Beutler Lab
Gene Symbol Hgf
Ensembl Gene ENSMUSG00000028864
Gene Namehepatocyte growth factor
SynonymsHGF/SF, NK1, C230052L06Rik, scatter factor, NK2, SF/HGF
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7296 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location16553495-16620152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16564843 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 105 (M105K)
Ref Sequence ENSEMBL: ENSMUSP00000030683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030683] [ENSMUST00000196645] [ENSMUST00000199581]
PDB Structure
A Mechanistic Basis for Converting a Receptor Tyrosine Kinase Agonist to an Antagonist [X-RAY DIFFRACTION]
Crystal structure of the N-terminal fragment (31-127) of the mouse hepatocyte growth factor/scatter factor [X-RAY DIFFRACTION]
Crystal Structure of the NK2 Fragment (31-290) of the mouse Hepatocyte Growth Factor/Scatter Factor [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000030683
AA Change: M105K

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030683
Gene: ENSMUSG00000028864
AA Change: M105K

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
PAN_AP 38 123 6.47e-13 SMART
KR 127 209 3.03e-46 SMART
KR 210 291 9.04e-45 SMART
KR 304 386 7.35e-45 SMART
KR 390 472 1.02e-38 SMART
Tryp_SPc 495 719 5.6e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196645
AA Change: M105K

PolyPhen 2 Score 0.341 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142517
Gene: ENSMUSG00000028864
AA Change: M105K

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
PAN_AP 38 123 6.47e-13 SMART
KR 127 204 3.76e-42 SMART
KR 205 286 9.04e-45 SMART
KR 299 381 7.35e-45 SMART
KR 385 467 1.02e-38 SMART
Tryp_SPc 490 714 5.6e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199581
AA Change: M105K

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143424
Gene: ENSMUSG00000028864
AA Change: M105K

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
PAN_AP 38 123 6.47e-13 SMART
KR 127 209 3.03e-46 SMART
KR 210 291 9.04e-45 SMART
KR 304 386 7.35e-45 SMART
KR 390 472 1.02e-38 SMART
Tryp_SPc 495 719 5.6e-55 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: This gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the hepatocyte growth factor alpha and beta chains, which heterodimerize to form the mature active protein. Although this protein is a member of the peptidase S1 family of serine proteases, it lacks peptidase activity. Homozygous knockout mice for this gene exhibit embryonic lethality due to impaired development of the placenta and liver. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced embryonic livers, impaired migration of dermomyotome precursors affecting skeletal muscle formation, defective navigation of hypoglossal motor axons, abnormal placentas, and prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik T A 1: 57,383,143 M226K probably benign Het
2010300C02Rik T C 1: 37,614,618 T1036A possibly damaging Het
4921524L21Rik T G 18: 6,626,385 S132R probably damaging Het
A4gnt T G 9: 99,620,282 I165S probably damaging Het
Abca14 G A 7: 120,278,311 D1061N probably benign Het
Abcc9 G A 6: 142,671,593 P582S probably damaging Het
Abhd5 G A 9: 122,379,573 V343I probably benign Het
Adam6a C T 12: 113,545,572 R522C probably damaging Het
Ankle2 G A 5: 110,237,724 R313H probably damaging Het
Aplf G A 6: 87,646,215 T315I probably damaging Het
Arntl2 G A 6: 146,822,134 V321I not run Het
Asic5 C T 3: 82,021,076 P491S probably benign Het
Atp5b T C 10: 128,085,522 Y230H probably benign Het
B4galt6 A T 18: 20,728,042 I51N probably damaging Het
C4b A G 17: 34,743,659 L23S probably damaging Het
C77080 A G 4: 129,225,418 Y170H probably damaging Het
Cables2 A G 2: 180,260,336 V410A Het
Cdyl A G 13: 35,863,395 M489V probably damaging Het
Clip4 T C 17: 71,790,001 M40T probably damaging Het
Col12a1 T C 9: 79,682,066 Y1069C probably damaging Het
Col6a3 T C 1: 90,827,986 M194V probably benign Het
Colec11 T A 12: 28,594,715 D260V probably damaging Het
Cux2 T C 5: 121,861,256 D1207G probably benign Het
Cyp2d34 G T 15: 82,617,235 N297K possibly damaging Het
Dmbt1 A G 7: 131,112,132 Y1643C unknown Het
Dnmt3c A G 2: 153,715,026 T288A probably benign Het
Dock8 T A 19: 25,184,881 F1842I probably benign Het
Dysf A G 6: 84,106,898 I740V probably benign Het
Epha6 T A 16: 59,915,838 M778L probably benign Het
Eri2 A T 7: 119,786,516 L254* probably null Het
Fam129b T C 2: 32,922,642 S468P possibly damaging Het
Fam43b A G 4: 138,395,841 F56S probably damaging Het
Fat4 C A 3: 38,889,145 S729* probably null Het
Fbxw22 C A 9: 109,382,075 W386L probably benign Het
Fgd6 T A 10: 94,044,047 C254* probably null Het
Fgd6 C A 10: 94,139,881 T1386K probably benign Het
Fkbp7 G T 2: 76,671,764 D98E possibly damaging Het
Gm8251 T A 1: 44,060,916 K341* probably null Het
Hectd1 C T 12: 51,785,852 C913Y possibly damaging Het
Icam1 A C 9: 21,019,015 D55A probably benign Het
Itga2 A C 13: 114,857,394 probably null Het
Kcnj5 A C 9: 32,322,749 L90R probably damaging Het
Klra17 T A 6: 129,831,592 N226I possibly damaging Het
Krt1 T A 15: 101,850,629 R33S unknown Het
L3mbtl3 T A 10: 26,282,830 D615V unknown Het
Lrp2 T A 2: 69,482,381 Y2521F probably benign Het
Megf10 A T 18: 57,275,753 N589I probably damaging Het
Metap1d G C 2: 71,506,785 G14A probably benign Het
Mfap5 T A 6: 122,528,422 D162E probably benign Het
Mixl1 T C 1: 180,696,958 I19V probably benign Het
Mtrr G T 13: 68,568,860 Y411* probably null Het
Myh7 T C 14: 54,990,025 T318A probably benign Het
Nbeal1 T A 1: 60,310,224 Y2348* probably null Het
Nlrc3 T C 16: 3,963,590 S668G probably damaging Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1129 T A 2: 87,575,708 V208E probably damaging Het
Olfr1222 C A 2: 89,124,836 R298S probably benign Het
Olfr527 A T 7: 140,336,741 D293V possibly damaging Het
Pcna A G 2: 132,252,877 S54P probably benign Het
Pde6a A G 18: 61,258,293 T570A probably damaging Het
Phf21b A T 15: 84,855,717 M1K probably null Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prob1 A G 18: 35,653,299 F634S possibly damaging Het
Prss50 A G 9: 110,861,289 T167A probably damaging Het
Ptpn1 T C 2: 167,974,772 V249A probably damaging Het
Rai1 G A 11: 60,188,673 V1188I probably benign Het
Ric1 G A 19: 29,584,578 probably null Het
Robo1 C T 16: 72,989,631 Q844* probably null Het
Rpn1 A G 6: 88,084,637 D36G possibly damaging Het
Serpinb1b A T 13: 33,093,827 M348L probably benign Het
Setd4 T C 16: 93,583,942 probably null Het
Setd5 T G 6: 113,147,557 S1124A probably benign Het
Slc35c1 C A 2: 92,458,739 V154F probably damaging Het
Slc7a6os G T 8: 106,210,489 S113* probably null Het
Syne2 T A 12: 76,103,036 D1787E probably benign Het
Tas2r144 A C 6: 42,215,439 I38L probably damaging Het
Tepsin G T 11: 120,091,708 T512K possibly damaging Het
Utp20 A G 10: 88,770,724 V1662A probably benign Het
Vmn1r201 C T 13: 22,475,339 A241V possibly damaging Het
Vmn2r60 T A 7: 42,136,402 S210T probably benign Het
Wdr6 G T 9: 108,574,585 H700N probably damaging Het
Zdhhc8 T C 16: 18,234,926 T29A probably benign Het
Zfp335 A G 2: 164,900,132 I614T probably damaging Het
Zfp54 T A 17: 21,433,582 S113T probably benign Het
Zfp873 T A 10: 82,061,237 C601S probably damaging Het
Zfyve26 T C 12: 79,278,372 probably null Het
Zmynd8 T C 2: 165,840,009 T201A probably damaging Het
Other mutations in Hgf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Hgf APN 5 16611882 missense possibly damaging 0.70
IGL00427:Hgf APN 5 16578486 missense probably benign 0.09
IGL00788:Hgf APN 5 16598230 missense probably damaging 0.99
IGL01290:Hgf APN 5 16604846 missense probably damaging 1.00
IGL01333:Hgf APN 5 16576941 nonsense probably null
IGL01568:Hgf APN 5 16564814 missense probably damaging 1.00
IGL02314:Hgf APN 5 16572602 missense probably damaging 0.99
IGL02328:Hgf APN 5 16598221 missense probably damaging 1.00
IGL02368:Hgf APN 5 16564794 missense possibly damaging 0.95
IGL02486:Hgf APN 5 16602289 missense probably damaging 1.00
IGL02654:Hgf APN 5 16561051 missense probably benign
Foiegras UTSW 5 16615802 missense probably benign 0.01
PIT4378001:Hgf UTSW 5 16611862 missense probably damaging 1.00
R0708:Hgf UTSW 5 16566763 nonsense probably null
R0710:Hgf UTSW 5 16566763 nonsense probably null
R0718:Hgf UTSW 5 16593859 missense probably damaging 1.00
R0967:Hgf UTSW 5 16593841 splice site probably benign
R1181:Hgf UTSW 5 16618925 missense probably damaging 1.00
R1589:Hgf UTSW 5 16613785 missense probably damaging 1.00
R1705:Hgf UTSW 5 16615802 missense probably benign 0.01
R1983:Hgf UTSW 5 16561012 missense possibly damaging 0.53
R2021:Hgf UTSW 5 16576921 missense probably benign
R2441:Hgf UTSW 5 16604790 missense probably damaging 0.99
R4083:Hgf UTSW 5 16615858 nonsense probably null
R4084:Hgf UTSW 5 16615858 nonsense probably null
R4211:Hgf UTSW 5 16614993 missense probably damaging 0.99
R4388:Hgf UTSW 5 16614943 missense probably benign 0.12
R4394:Hgf UTSW 5 16618951 nonsense probably null
R4575:Hgf UTSW 5 16572601 missense probably benign
R5044:Hgf UTSW 5 16614894 missense probably benign 0.00
R5319:Hgf UTSW 5 16566862 critical splice donor site probably null
R5585:Hgf UTSW 5 16564801 missense possibly damaging 0.93
R5700:Hgf UTSW 5 16610124 missense probably damaging 1.00
R5814:Hgf UTSW 5 16602307 missense probably benign 0.19
R6125:Hgf UTSW 5 16598161 missense probably damaging 1.00
R6749:Hgf UTSW 5 16613642 intron probably null
R6891:Hgf UTSW 5 16604922 critical splice donor site probably null
R6962:Hgf UTSW 5 16615754 missense probably benign 0.32
R7251:Hgf UTSW 5 16593944 missense possibly damaging 0.95
R7463:Hgf UTSW 5 16578450 missense probably benign 0.00
R7470:Hgf UTSW 5 16618856 missense probably benign 0.02
R7630:Hgf UTSW 5 16598250 missense probably benign 0.01
R7807:Hgf UTSW 5 16577011 missense probably damaging 0.99
X0024:Hgf UTSW 5 16604828 missense probably damaging 1.00
Z1088:Hgf UTSW 5 16618919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCACAGAGTCTTGATCTCG -3'
(R):5'- GTGGCACAAATCAGAATCTGAC -3'

Sequencing Primer
(F):5'- TGCTCCTTTGAAATAGGACACAC -3'
(R):5'- TCAGAATCTGACCAAAACATCCACAG -3'
Posted On2019-09-13