Incidental Mutation 'R7296:Tas2r144'
ID 571613
Institutional Source Beutler Lab
Gene Symbol Tas2r144
Ensembl Gene ENSMUSG00000051917
Gene Name taste receptor, type 2, member 144
Synonyms mt2r33, Tas2r44
MMRRC Submission 045400-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R7296 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 42192262-42193221 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 42192373 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 38 (I38L)
Ref Sequence ENSEMBL: ENSMUSP00000067734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063489]
AlphaFold Q7TQB8
Predicted Effect probably damaging
Transcript: ENSMUST00000063489
AA Change: I38L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067734
Gene: ENSMUSG00000051917
AA Change: I38L

DomainStartEndE-ValueType
Pfam:TAS2R 12 314 9.6e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (85/87)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik T A 1: 57,422,302 (GRCm39) M226K probably benign Het
4921524L21Rik T G 18: 6,626,385 (GRCm39) S132R probably damaging Het
A4gnt T G 9: 99,502,335 (GRCm39) I165S probably damaging Het
Abca14 G A 7: 119,877,534 (GRCm39) D1061N probably benign Het
Abcc9 G A 6: 142,617,319 (GRCm39) P582S probably damaging Het
Abhd5 G A 9: 122,208,638 (GRCm39) V343I probably benign Het
Adam6a C T 12: 113,509,192 (GRCm39) R522C probably damaging Het
Ankle2 G A 5: 110,385,590 (GRCm39) R313H probably damaging Het
Aplf G A 6: 87,623,197 (GRCm39) T315I probably damaging Het
Asic5 C T 3: 81,928,383 (GRCm39) P491S probably benign Het
Atp5f1b T C 10: 127,921,391 (GRCm39) Y230H probably benign Het
B4galt6 A T 18: 20,861,099 (GRCm39) I51N probably damaging Het
Bmal2 G A 6: 146,723,632 (GRCm39) V321I not run Het
C4b A G 17: 34,962,633 (GRCm39) L23S probably damaging Het
Cables2 A G 2: 179,902,129 (GRCm39) V410A Het
Ccdc168 T A 1: 44,100,076 (GRCm39) K341* probably null Het
Cdyl A G 13: 36,047,378 (GRCm39) M489V probably damaging Het
Clip4 T C 17: 72,096,996 (GRCm39) M40T probably damaging Het
Col12a1 T C 9: 79,589,348 (GRCm39) Y1069C probably damaging Het
Col6a3 T C 1: 90,755,708 (GRCm39) M194V probably benign Het
Colec11 T A 12: 28,644,714 (GRCm39) D260V probably damaging Het
Cracdl T C 1: 37,653,699 (GRCm39) T1036A possibly damaging Het
Cux2 T C 5: 121,999,319 (GRCm39) D1207G probably benign Het
Cyp2d34 G T 15: 82,501,436 (GRCm39) N297K possibly damaging Het
Dmbt1 A G 7: 130,713,861 (GRCm39) Y1643C unknown Het
Dnmt3c A G 2: 153,556,946 (GRCm39) T288A probably benign Het
Dock8 T A 19: 25,162,245 (GRCm39) F1842I probably benign Het
Dysf A G 6: 84,083,880 (GRCm39) I740V probably benign Het
Epha6 T A 16: 59,736,201 (GRCm39) M778L probably benign Het
Eri2 A T 7: 119,385,739 (GRCm39) L254* probably null Het
Fam43b A G 4: 138,123,152 (GRCm39) F56S probably damaging Het
Fat4 C A 3: 38,943,294 (GRCm39) S729* probably null Het
Fbxw22 C A 9: 109,211,143 (GRCm39) W386L probably benign Het
Fgd6 T A 10: 93,879,909 (GRCm39) C254* probably null Het
Fgd6 C A 10: 93,975,743 (GRCm39) T1386K probably benign Het
Fkbp7 G T 2: 76,502,108 (GRCm39) D98E possibly damaging Het
Hectd1 C T 12: 51,832,635 (GRCm39) C913Y possibly damaging Het
Hgf T A 5: 16,769,841 (GRCm39) M105K probably benign Het
Icam1 A C 9: 20,930,311 (GRCm39) D55A probably benign Het
Itga2 A C 13: 114,993,930 (GRCm39) probably null Het
Kcnj5 A C 9: 32,234,045 (GRCm39) L90R probably damaging Het
Klra17 T A 6: 129,808,555 (GRCm39) N226I possibly damaging Het
Krt1 T A 15: 101,759,064 (GRCm39) R33S unknown Het
L3mbtl3 T A 10: 26,158,728 (GRCm39) D615V unknown Het
Lrp2 T A 2: 69,312,725 (GRCm39) Y2521F probably benign Het
Megf10 A T 18: 57,408,825 (GRCm39) N589I probably damaging Het
Metap1d G C 2: 71,337,129 (GRCm39) G14A probably benign Het
Mfap5 T A 6: 122,505,381 (GRCm39) D162E probably benign Het
Mixl1 T C 1: 180,524,523 (GRCm39) I19V probably benign Het
Mtrr G T 13: 68,716,979 (GRCm39) Y411* probably null Het
Myh7 T C 14: 55,227,482 (GRCm39) T318A probably benign Het
Nbeal1 T A 1: 60,349,383 (GRCm39) Y2348* probably null Het
Nhsl3 A G 4: 129,119,211 (GRCm39) Y170H probably damaging Het
Niban2 T C 2: 32,812,654 (GRCm39) S468P possibly damaging Het
Nlrc3 T C 16: 3,781,454 (GRCm39) S668G probably damaging Het
Nutm1 G A 2: 112,080,401 (GRCm39) R505C probably damaging Het
Or10ag59 T A 2: 87,406,052 (GRCm39) V208E probably damaging Het
Or12j2 A T 7: 139,916,654 (GRCm39) D293V possibly damaging Het
Or4c117 C A 2: 88,955,180 (GRCm39) R298S probably benign Het
Pcna A G 2: 132,094,797 (GRCm39) S54P probably benign Het
Pde6a A G 18: 61,391,364 (GRCm39) T570A probably damaging Het
Phf21b A T 15: 84,739,918 (GRCm39) M1K probably null Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Prob1 A G 18: 35,786,352 (GRCm39) F634S possibly damaging Het
Prss50 A G 9: 110,690,357 (GRCm39) T167A probably damaging Het
Ptpn1 T C 2: 167,816,692 (GRCm39) V249A probably damaging Het
Rai1 G A 11: 60,079,499 (GRCm39) V1188I probably benign Het
Ric1 G A 19: 29,561,978 (GRCm39) probably null Het
Robo1 C T 16: 72,786,519 (GRCm39) Q844* probably null Het
Rpn1 A G 6: 88,061,619 (GRCm39) D36G possibly damaging Het
Serpinb1b A T 13: 33,277,810 (GRCm39) M348L probably benign Het
Setd4 T C 16: 93,380,830 (GRCm39) probably null Het
Setd5 T G 6: 113,124,518 (GRCm39) S1124A probably benign Het
Slc35c1 C A 2: 92,289,084 (GRCm39) V154F probably damaging Het
Slc7a6os G T 8: 106,937,121 (GRCm39) S113* probably null Het
Syne2 T A 12: 76,149,810 (GRCm39) D1787E probably benign Het
Tepsin G T 11: 119,982,534 (GRCm39) T512K possibly damaging Het
Utp20 A G 10: 88,606,586 (GRCm39) V1662A probably benign Het
Vmn1r201 C T 13: 22,659,509 (GRCm39) A241V possibly damaging Het
Vmn2r60 T A 7: 41,785,826 (GRCm39) S210T probably benign Het
Wdr6 G T 9: 108,451,784 (GRCm39) H700N probably damaging Het
Zdhhc8 T C 16: 18,052,790 (GRCm39) T29A probably benign Het
Zfp335 A G 2: 164,742,052 (GRCm39) I614T probably damaging Het
Zfp54 T A 17: 21,653,844 (GRCm39) S113T probably benign Het
Zfp873 T A 10: 81,897,071 (GRCm39) C601S probably damaging Het
Zfyve26 T C 12: 79,325,146 (GRCm39) probably null Het
Zmynd8 T C 2: 165,681,929 (GRCm39) T201A probably damaging Het
Other mutations in Tas2r144
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02349:Tas2r144 APN 6 42,193,010 (GRCm39) missense probably benign 0.26
IGL02644:Tas2r144 APN 6 42,192,787 (GRCm39) missense possibly damaging 0.89
IGL02816:Tas2r144 APN 6 42,192,539 (GRCm39) missense probably benign 0.03
R0375:Tas2r144 UTSW 6 42,193,058 (GRCm39) missense possibly damaging 0.92
R1526:Tas2r144 UTSW 6 42,192,674 (GRCm39) missense probably benign
R1543:Tas2r144 UTSW 6 42,192,537 (GRCm39) missense probably benign 0.00
R1678:Tas2r144 UTSW 6 42,192,490 (GRCm39) missense probably benign 0.44
R1868:Tas2r144 UTSW 6 42,192,936 (GRCm39) missense probably benign 0.01
R1880:Tas2r144 UTSW 6 42,193,004 (GRCm39) missense probably benign 0.02
R4060:Tas2r144 UTSW 6 42,192,563 (GRCm39) missense possibly damaging 0.82
R5173:Tas2r144 UTSW 6 42,193,048 (GRCm39) missense probably benign 0.40
R6108:Tas2r144 UTSW 6 42,192,691 (GRCm39) missense possibly damaging 0.88
R6249:Tas2r144 UTSW 6 42,192,291 (GRCm39) nonsense probably null
R6533:Tas2r144 UTSW 6 42,192,280 (GRCm39) missense probably benign
R6850:Tas2r144 UTSW 6 42,192,857 (GRCm39) missense possibly damaging 0.71
R7237:Tas2r144 UTSW 6 42,192,800 (GRCm39) missense probably damaging 0.99
R7431:Tas2r144 UTSW 6 42,192,908 (GRCm39) missense probably damaging 1.00
R8206:Tas2r144 UTSW 6 42,192,325 (GRCm39) missense probably damaging 0.98
R9341:Tas2r144 UTSW 6 42,193,066 (GRCm39) missense probably benign 0.03
R9343:Tas2r144 UTSW 6 42,193,066 (GRCm39) missense probably benign 0.03
R9640:Tas2r144 UTSW 6 42,192,428 (GRCm39) missense probably benign 0.00
X0067:Tas2r144 UTSW 6 42,193,099 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATTACAGGGCAGACACC -3'
(R):5'- AGACATTGAGCCAAGCAGC -3'

Sequencing Primer
(F):5'- GATTACAGGGCAGACACCACTTC -3'
(R):5'- CAAACCAGAGGTTACAGTAGTTTAG -3'
Posted On 2019-09-13