Incidental Mutation 'R7296:Abca14'
ID 571624
Institutional Source Beutler Lab
Gene Symbol Abca14
Ensembl Gene ENSMUSG00000062017
Gene Name ATP-binding cassette, sub-family A member 14
Synonyms 1700110B15Rik, 4930539G24Rik
MMRRC Submission 045400-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7296 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 119803184-119924575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 119877534 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 1061 (D1061N)
Ref Sequence ENSEMBL: ENSMUSP00000081690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084640]
AlphaFold E9Q8F8
Predicted Effect probably benign
Transcript: ENSMUST00000084640
AA Change: D1061N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081690
Gene: ENSMUSG00000062017
AA Change: D1061N

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 463 5.7e-23 PFAM
AAA 548 729 1.59e-10 SMART
Pfam:ABC2_membrane_3 902 1296 1.2e-36 PFAM
AAA 1384 1568 1.33e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (85/87)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik T A 1: 57,422,302 (GRCm39) M226K probably benign Het
4921524L21Rik T G 18: 6,626,385 (GRCm39) S132R probably damaging Het
A4gnt T G 9: 99,502,335 (GRCm39) I165S probably damaging Het
Abcc9 G A 6: 142,617,319 (GRCm39) P582S probably damaging Het
Abhd5 G A 9: 122,208,638 (GRCm39) V343I probably benign Het
Adam6a C T 12: 113,509,192 (GRCm39) R522C probably damaging Het
Ankle2 G A 5: 110,385,590 (GRCm39) R313H probably damaging Het
Aplf G A 6: 87,623,197 (GRCm39) T315I probably damaging Het
Asic5 C T 3: 81,928,383 (GRCm39) P491S probably benign Het
Atp5f1b T C 10: 127,921,391 (GRCm39) Y230H probably benign Het
B4galt6 A T 18: 20,861,099 (GRCm39) I51N probably damaging Het
Bmal2 G A 6: 146,723,632 (GRCm39) V321I not run Het
C4b A G 17: 34,962,633 (GRCm39) L23S probably damaging Het
Cables2 A G 2: 179,902,129 (GRCm39) V410A Het
Ccdc168 T A 1: 44,100,076 (GRCm39) K341* probably null Het
Cdyl A G 13: 36,047,378 (GRCm39) M489V probably damaging Het
Clip4 T C 17: 72,096,996 (GRCm39) M40T probably damaging Het
Col12a1 T C 9: 79,589,348 (GRCm39) Y1069C probably damaging Het
Col6a3 T C 1: 90,755,708 (GRCm39) M194V probably benign Het
Colec11 T A 12: 28,644,714 (GRCm39) D260V probably damaging Het
Cracdl T C 1: 37,653,699 (GRCm39) T1036A possibly damaging Het
Cux2 T C 5: 121,999,319 (GRCm39) D1207G probably benign Het
Cyp2d34 G T 15: 82,501,436 (GRCm39) N297K possibly damaging Het
Dmbt1 A G 7: 130,713,861 (GRCm39) Y1643C unknown Het
Dnmt3c A G 2: 153,556,946 (GRCm39) T288A probably benign Het
Dock8 T A 19: 25,162,245 (GRCm39) F1842I probably benign Het
Dysf A G 6: 84,083,880 (GRCm39) I740V probably benign Het
Epha6 T A 16: 59,736,201 (GRCm39) M778L probably benign Het
Eri2 A T 7: 119,385,739 (GRCm39) L254* probably null Het
Fam43b A G 4: 138,123,152 (GRCm39) F56S probably damaging Het
Fat4 C A 3: 38,943,294 (GRCm39) S729* probably null Het
Fbxw22 C A 9: 109,211,143 (GRCm39) W386L probably benign Het
Fgd6 T A 10: 93,879,909 (GRCm39) C254* probably null Het
Fgd6 C A 10: 93,975,743 (GRCm39) T1386K probably benign Het
Fkbp7 G T 2: 76,502,108 (GRCm39) D98E possibly damaging Het
Hectd1 C T 12: 51,832,635 (GRCm39) C913Y possibly damaging Het
Hgf T A 5: 16,769,841 (GRCm39) M105K probably benign Het
Icam1 A C 9: 20,930,311 (GRCm39) D55A probably benign Het
Itga2 A C 13: 114,993,930 (GRCm39) probably null Het
Kcnj5 A C 9: 32,234,045 (GRCm39) L90R probably damaging Het
Klra17 T A 6: 129,808,555 (GRCm39) N226I possibly damaging Het
Krt1 T A 15: 101,759,064 (GRCm39) R33S unknown Het
L3mbtl3 T A 10: 26,158,728 (GRCm39) D615V unknown Het
Lrp2 T A 2: 69,312,725 (GRCm39) Y2521F probably benign Het
Megf10 A T 18: 57,408,825 (GRCm39) N589I probably damaging Het
Metap1d G C 2: 71,337,129 (GRCm39) G14A probably benign Het
Mfap5 T A 6: 122,505,381 (GRCm39) D162E probably benign Het
Mixl1 T C 1: 180,524,523 (GRCm39) I19V probably benign Het
Mtrr G T 13: 68,716,979 (GRCm39) Y411* probably null Het
Myh7 T C 14: 55,227,482 (GRCm39) T318A probably benign Het
Nbeal1 T A 1: 60,349,383 (GRCm39) Y2348* probably null Het
Nhsl3 A G 4: 129,119,211 (GRCm39) Y170H probably damaging Het
Niban2 T C 2: 32,812,654 (GRCm39) S468P possibly damaging Het
Nlrc3 T C 16: 3,781,454 (GRCm39) S668G probably damaging Het
Nutm1 G A 2: 112,080,401 (GRCm39) R505C probably damaging Het
Or10ag59 T A 2: 87,406,052 (GRCm39) V208E probably damaging Het
Or12j2 A T 7: 139,916,654 (GRCm39) D293V possibly damaging Het
Or4c117 C A 2: 88,955,180 (GRCm39) R298S probably benign Het
Pcna A G 2: 132,094,797 (GRCm39) S54P probably benign Het
Pde6a A G 18: 61,391,364 (GRCm39) T570A probably damaging Het
Phf21b A T 15: 84,739,918 (GRCm39) M1K probably null Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Prob1 A G 18: 35,786,352 (GRCm39) F634S possibly damaging Het
Prss50 A G 9: 110,690,357 (GRCm39) T167A probably damaging Het
Ptpn1 T C 2: 167,816,692 (GRCm39) V249A probably damaging Het
Rai1 G A 11: 60,079,499 (GRCm39) V1188I probably benign Het
Ric1 G A 19: 29,561,978 (GRCm39) probably null Het
Robo1 C T 16: 72,786,519 (GRCm39) Q844* probably null Het
Rpn1 A G 6: 88,061,619 (GRCm39) D36G possibly damaging Het
Serpinb1b A T 13: 33,277,810 (GRCm39) M348L probably benign Het
Setd4 T C 16: 93,380,830 (GRCm39) probably null Het
Setd5 T G 6: 113,124,518 (GRCm39) S1124A probably benign Het
Slc35c1 C A 2: 92,289,084 (GRCm39) V154F probably damaging Het
Slc7a6os G T 8: 106,937,121 (GRCm39) S113* probably null Het
Syne2 T A 12: 76,149,810 (GRCm39) D1787E probably benign Het
Tas2r144 A C 6: 42,192,373 (GRCm39) I38L probably damaging Het
Tepsin G T 11: 119,982,534 (GRCm39) T512K possibly damaging Het
Utp20 A G 10: 88,606,586 (GRCm39) V1662A probably benign Het
Vmn1r201 C T 13: 22,659,509 (GRCm39) A241V possibly damaging Het
Vmn2r60 T A 7: 41,785,826 (GRCm39) S210T probably benign Het
Wdr6 G T 9: 108,451,784 (GRCm39) H700N probably damaging Het
Zdhhc8 T C 16: 18,052,790 (GRCm39) T29A probably benign Het
Zfp335 A G 2: 164,742,052 (GRCm39) I614T probably damaging Het
Zfp54 T A 17: 21,653,844 (GRCm39) S113T probably benign Het
Zfp873 T A 10: 81,897,071 (GRCm39) C601S probably damaging Het
Zfyve26 T C 12: 79,325,146 (GRCm39) probably null Het
Zmynd8 T C 2: 165,681,929 (GRCm39) T201A probably damaging Het
Other mutations in Abca14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Abca14 APN 7 119,846,076 (GRCm39) missense probably damaging 1.00
IGL00800:Abca14 APN 7 119,854,613 (GRCm39) missense probably benign 0.01
IGL00845:Abca14 APN 7 119,823,174 (GRCm39) splice site probably benign
IGL00897:Abca14 APN 7 119,815,348 (GRCm39) splice site probably benign
IGL01524:Abca14 APN 7 119,852,644 (GRCm39) missense possibly damaging 0.57
IGL01747:Abca14 APN 7 119,877,310 (GRCm39) missense probably benign 0.00
IGL02214:Abca14 APN 7 119,893,398 (GRCm39) missense probably benign 0.09
IGL02215:Abca14 APN 7 119,852,612 (GRCm39) missense probably benign 0.00
IGL02253:Abca14 APN 7 119,807,182 (GRCm39) missense probably benign 0.29
IGL02302:Abca14 APN 7 119,917,968 (GRCm39) splice site probably benign
IGL03391:Abca14 APN 7 119,846,107 (GRCm39) missense probably damaging 1.00
F6893:Abca14 UTSW 7 119,924,261 (GRCm39) missense probably damaging 0.98
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0265:Abca14 UTSW 7 119,822,850 (GRCm39) missense probably benign 0.03
R0326:Abca14 UTSW 7 119,823,642 (GRCm39) missense probably damaging 1.00
R0380:Abca14 UTSW 7 119,877,703 (GRCm39) missense probably benign 0.03
R0418:Abca14 UTSW 7 119,806,657 (GRCm39) missense probably damaging 1.00
R0539:Abca14 UTSW 7 119,807,020 (GRCm39) missense probably damaging 1.00
R0574:Abca14 UTSW 7 119,823,720 (GRCm39) missense probably damaging 0.96
R0611:Abca14 UTSW 7 119,851,479 (GRCm39) missense possibly damaging 0.63
R0783:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0785:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0863:Abca14 UTSW 7 119,815,453 (GRCm39) missense probably benign 0.03
R1034:Abca14 UTSW 7 119,815,370 (GRCm39) missense probably damaging 1.00
R1056:Abca14 UTSW 7 119,924,295 (GRCm39) missense probably damaging 1.00
R1072:Abca14 UTSW 7 119,811,992 (GRCm39) missense probably benign
R1244:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1255:Abca14 UTSW 7 119,807,016 (GRCm39) missense probably damaging 0.97
R1271:Abca14 UTSW 7 119,924,340 (GRCm39) missense probably damaging 1.00
R1325:Abca14 UTSW 7 119,846,545 (GRCm39) missense probably benign 0.32
R1457:Abca14 UTSW 7 119,888,683 (GRCm39) missense probably benign 0.00
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1494:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R1551:Abca14 UTSW 7 119,918,101 (GRCm39) missense probably benign 0.10
R1607:Abca14 UTSW 7 119,850,514 (GRCm39) missense probably damaging 1.00
R1739:Abca14 UTSW 7 119,877,529 (GRCm39) missense probably benign 0.04
R1856:Abca14 UTSW 7 119,877,404 (GRCm39) missense probably damaging 1.00
R1875:Abca14 UTSW 7 119,847,190 (GRCm39) missense possibly damaging 0.78
R1892:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1898:Abca14 UTSW 7 119,850,392 (GRCm39) missense probably damaging 1.00
R1958:Abca14 UTSW 7 119,924,382 (GRCm39) missense probably damaging 0.98
R2018:Abca14 UTSW 7 119,815,408 (GRCm39) missense probably benign 0.00
R2039:Abca14 UTSW 7 119,911,487 (GRCm39) missense probably damaging 0.98
R2060:Abca14 UTSW 7 119,826,741 (GRCm39) nonsense probably null
R2202:Abca14 UTSW 7 119,888,764 (GRCm39) missense probably benign 0.17
R2205:Abca14 UTSW 7 119,846,503 (GRCm39) missense probably damaging 0.98
R2360:Abca14 UTSW 7 119,850,431 (GRCm39) missense probably benign 0.00
R2401:Abca14 UTSW 7 119,882,312 (GRCm39) missense probably damaging 1.00
R2426:Abca14 UTSW 7 119,882,446 (GRCm39) missense probably benign 0.04
R3433:Abca14 UTSW 7 119,893,455 (GRCm39) missense probably damaging 0.97
R4598:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4599:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4700:Abca14 UTSW 7 119,911,928 (GRCm39) critical splice donor site probably null
R4751:Abca14 UTSW 7 119,911,400 (GRCm39) missense probably benign 0.01
R4826:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4828:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4837:Abca14 UTSW 7 119,846,203 (GRCm39) missense probably benign
R4881:Abca14 UTSW 7 119,877,472 (GRCm39) missense possibly damaging 0.49
R4895:Abca14 UTSW 7 119,846,572 (GRCm39) critical splice donor site probably null
R4928:Abca14 UTSW 7 119,923,803 (GRCm39) missense possibly damaging 0.90
R4990:Abca14 UTSW 7 119,911,388 (GRCm39) missense probably benign 0.00
R5027:Abca14 UTSW 7 119,911,505 (GRCm39) missense probably benign 0.05
R5091:Abca14 UTSW 7 119,851,497 (GRCm39) missense probably damaging 1.00
R5158:Abca14 UTSW 7 119,852,652 (GRCm39) missense probably benign
R5209:Abca14 UTSW 7 119,832,130 (GRCm39) missense probably benign 0.01
R5333:Abca14 UTSW 7 119,888,769 (GRCm39) nonsense probably null
R5424:Abca14 UTSW 7 119,810,777 (GRCm39) missense probably benign 0.01
R5488:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5489:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5716:Abca14 UTSW 7 119,846,217 (GRCm39) critical splice donor site probably null
R6450:Abca14 UTSW 7 119,815,449 (GRCm39) missense probably benign 0.17
R6477:Abca14 UTSW 7 119,924,325 (GRCm39) missense probably benign 0.44
R6652:Abca14 UTSW 7 119,846,164 (GRCm39) missense probably damaging 1.00
R6782:Abca14 UTSW 7 119,847,308 (GRCm39) missense probably damaging 1.00
R6874:Abca14 UTSW 7 119,851,428 (GRCm39) missense possibly damaging 0.71
R6965:Abca14 UTSW 7 119,882,452 (GRCm39) nonsense probably null
R7142:Abca14 UTSW 7 119,850,406 (GRCm39) missense possibly damaging 0.89
R7146:Abca14 UTSW 7 119,854,520 (GRCm39) missense probably benign 0.15
R7202:Abca14 UTSW 7 119,917,236 (GRCm39) missense probably damaging 1.00
R7220:Abca14 UTSW 7 119,826,667 (GRCm39) missense possibly damaging 0.45
R7241:Abca14 UTSW 7 119,846,184 (GRCm39) missense probably damaging 1.00
R7291:Abca14 UTSW 7 119,888,832 (GRCm39) nonsense probably null
R7298:Abca14 UTSW 7 119,807,106 (GRCm39) missense probably benign 0.00
R7315:Abca14 UTSW 7 119,893,341 (GRCm39) missense probably benign 0.00
R7776:Abca14 UTSW 7 119,832,214 (GRCm39) critical splice donor site probably null
R7820:Abca14 UTSW 7 119,811,944 (GRCm39) missense probably benign 0.42
R7873:Abca14 UTSW 7 119,888,792 (GRCm39) missense probably benign 0.17
R8215:Abca14 UTSW 7 119,893,425 (GRCm39) missense probably benign
R8332:Abca14 UTSW 7 119,815,436 (GRCm39) missense probably benign
R8419:Abca14 UTSW 7 119,815,489 (GRCm39) missense probably benign 0.08
R8444:Abca14 UTSW 7 119,918,133 (GRCm39) missense probably damaging 1.00
R8818:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R8834:Abca14 UTSW 7 119,877,372 (GRCm39) missense probably benign 0.02
R8845:Abca14 UTSW 7 119,846,428 (GRCm39) missense probably benign 0.00
R8889:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8892:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8894:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably damaging 1.00
R8903:Abca14 UTSW 7 119,815,526 (GRCm39) missense probably damaging 0.98
R8950:Abca14 UTSW 7 119,823,595 (GRCm39) missense possibly damaging 0.92
R8950:Abca14 UTSW 7 119,823,644 (GRCm39) nonsense probably null
R9018:Abca14 UTSW 7 119,918,532 (GRCm39) missense probably damaging 0.98
R9018:Abca14 UTSW 7 119,888,763 (GRCm39) missense probably benign 0.01
R9110:Abca14 UTSW 7 119,831,615 (GRCm39) intron probably benign
R9254:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9376:Abca14 UTSW 7 119,893,438 (GRCm39) missense probably damaging 1.00
R9378:Abca14 UTSW 7 119,807,191 (GRCm39) missense possibly damaging 0.64
R9379:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9388:Abca14 UTSW 7 119,882,261 (GRCm39) missense probably benign 0.01
R9445:Abca14 UTSW 7 119,877,691 (GRCm39) missense probably benign 0.05
R9522:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably null 0.98
R9577:Abca14 UTSW 7 119,810,768 (GRCm39) missense probably benign 0.27
R9627:Abca14 UTSW 7 119,854,530 (GRCm39) missense probably benign 0.00
R9639:Abca14 UTSW 7 119,893,345 (GRCm39) missense probably benign 0.01
R9660:Abca14 UTSW 7 119,851,478 (GRCm39) missense probably benign 0.00
R9696:Abca14 UTSW 7 119,888,734 (GRCm39) missense possibly damaging 0.59
R9709:Abca14 UTSW 7 119,888,739 (GRCm39) nonsense probably null
R9780:Abca14 UTSW 7 119,911,447 (GRCm39) missense probably benign 0.00
Z1088:Abca14 UTSW 7 119,815,358 (GRCm39) missense probably benign 0.14
Z1176:Abca14 UTSW 7 119,846,146 (GRCm39) missense probably damaging 1.00
Z1177:Abca14 UTSW 7 119,917,210 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTTGATGTTACCACAGAAG -3'
(R):5'- TCATGAGGCAAAAGCCACTG -3'

Sequencing Primer
(F):5'- CCTTGATGTTACCACAGAAGAAAAG -3'
(R):5'- GCCACTGGTGAAGATACTCATC -3'
Posted On 2019-09-13