Mutagenetix > Incidental Mutation

Incidental Mutation 'R7296:L3mbtl3'

571637

Institutional Source

Beutler Lab

Gene Symbol

L3mbtl3

Ensembl Gene

ENSMUSG00000039089

Gene Name

L3MBTL3 histone methyl-lysine binding protein

Synonyms

MBT-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7296 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

26274468-26375971 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 26282830 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 615 (D615V)

Ref Sequence

ENSEMBL: ENSMUSP00000101158 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040219] [ENSMUST00000105519] [ENSMUST00000174766]

AlphaFold

Q8BLB7

Predicted Effect

unknown
Transcript: ENSMUST00000040219
AA Change: D640V

SMART Domains

Protein: ENSMUSP00000037619
Gene: ENSMUSG00000039089
AA Change: D640V

Domain	Start	End	E-Value	Type
low complexity region	154	166	N/A	INTRINSIC
low complexity region	204	214	N/A	INTRINSIC
MBT	232	332	3.75e-48	SMART
MBT	340	439	3.67e-42	SMART
MBT	448	543	7.5e-48	SMART
low complexity region	604	615	N/A	INTRINSIC
low complexity region	662	770	N/A	INTRINSIC
SAM	808	875	2.49e-13	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000105519
AA Change: D615V

SMART Domains

Protein: ENSMUSP00000101158
Gene: ENSMUSG00000039089
AA Change: D615V

Domain	Start	End	E-Value	Type
low complexity region	129	141	N/A	INTRINSIC
low complexity region	179	189	N/A	INTRINSIC
MBT	207	307	3.75e-48	SMART
MBT	315	414	3.67e-42	SMART
MBT	423	518	7.5e-48	SMART
low complexity region	579	590	N/A	INTRINSIC
low complexity region	637	745	N/A	INTRINSIC
SAM	783	850	2.49e-13	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000174766
AA Change: D640V

SMART Domains

Protein: ENSMUSP00000133479
Gene: ENSMUSG00000039089
AA Change: D640V

Domain	Start	End	E-Value	Type
low complexity region	154	166	N/A	INTRINSIC
low complexity region	204	214	N/A	INTRINSIC
MBT	232	332	3.75e-48	SMART
MBT	340	439	3.67e-42	SMART
MBT	448	543	7.5e-48	SMART
low complexity region	604	615	N/A	INTRINSIC
low complexity region	662	770	N/A	INTRINSIC
SAM	808	875	2.49e-13	SMART

Meta Mutation Damage Score

0.0780

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.8%

Validation Efficiency

98% (85/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the malignant brain tumor (MBT) family of chromatin interacting transcriptional repressors. Members of this family function as methyl-lysine readers, which recognize methylated lysine residues on histone protein tails, and are associated with the repression of gene expression. The encoded protein may regulate hematopoiesis. Homozygous deletion of this gene has been observed in human patients with medulloblastoma. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null mutation die between E17.5 ? 19.5 due to disturbed erythropoiesis which result in anemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700066M21Rik	T	A	1: 57,383,143	M226K	probably benign	Het
2010300C02Rik	T	C	1: 37,614,618	T1036A	possibly damaging	Het
4921524L21Rik	T	G	18: 6,626,385	S132R	probably damaging	Het
A4gnt	T	G	9: 99,620,282	I165S	probably damaging	Het
Abca14	G	A	7: 120,278,311	D1061N	probably benign	Het
Abcc9	G	A	6: 142,671,593	P582S	probably damaging	Het
Abhd5	G	A	9: 122,379,573	V343I	probably benign	Het
Adam6a	C	T	12: 113,545,572	R522C	probably damaging	Het
Ankle2	G	A	5: 110,237,724	R313H	probably damaging	Het
Aplf	G	A	6: 87,646,215	T315I	probably damaging	Het
Arntl2	G	A	6: 146,822,134	V321I	not run	Het
Asic5	C	T	3: 82,021,076	P491S	probably benign	Het
Atp5b	T	C	10: 128,085,522	Y230H	probably benign	Het
B4galt6	A	T	18: 20,728,042	I51N	probably damaging	Het
C4b	A	G	17: 34,743,659	L23S	probably damaging	Het
C77080	A	G	4: 129,225,418	Y170H	probably damaging	Het
Cables2	A	G	2: 180,260,336	V410A		Het
Cdyl	A	G	13: 35,863,395	M489V	probably damaging	Het
Clip4	T	C	17: 71,790,001	M40T	probably damaging	Het
Col12a1	T	C	9: 79,682,066	Y1069C	probably damaging	Het
Col6a3	T	C	1: 90,827,986	M194V	probably benign	Het
Colec11	T	A	12: 28,594,715	D260V	probably damaging	Het
Cux2	T	C	5: 121,861,256	D1207G	probably benign	Het
Cyp2d34	G	T	15: 82,617,235	N297K	possibly damaging	Het
Dmbt1	A	G	7: 131,112,132	Y1643C	unknown	Het
Dnmt3c	A	G	2: 153,715,026	T288A	probably benign	Het
Dock8	T	A	19: 25,184,881	F1842I	probably benign	Het
Dysf	A	G	6: 84,106,898	I740V	probably benign	Het
Epha6	T	A	16: 59,915,838	M778L	probably benign	Het
Eri2	A	T	7: 119,786,516	L254*	probably null	Het
Fam129b	T	C	2: 32,922,642	S468P	possibly damaging	Het
Fam43b	A	G	4: 138,395,841	F56S	probably damaging	Het
Fat4	C	A	3: 38,889,145	S729*	probably null	Het
Fbxw22	C	A	9: 109,382,075	W386L	probably benign	Het
Fgd6	T	A	10: 94,044,047	C254*	probably null	Het
Fgd6	C	A	10: 94,139,881	T1386K	probably benign	Het
Fkbp7	G	T	2: 76,671,764	D98E	possibly damaging	Het
Gm8251	T	A	1: 44,060,916	K341*	probably null	Het
Hectd1	C	T	12: 51,785,852	C913Y	possibly damaging	Het
Hgf	T	A	5: 16,564,843	M105K	probably benign	Het
Icam1	A	C	9: 21,019,015	D55A	probably benign	Het
Itga2	A	C	13: 114,857,394		probably null	Het
Kcnj5	A	C	9: 32,322,749	L90R	probably damaging	Het
Klra17	T	A	6: 129,831,592	N226I	possibly damaging	Het
Krt1	T	A	15: 101,850,629	R33S	unknown	Het
Lrp2	T	A	2: 69,482,381	Y2521F	probably benign	Het
Megf10	A	T	18: 57,275,753	N589I	probably damaging	Het
Metap1d	G	C	2: 71,506,785	G14A	probably benign	Het
Mfap5	T	A	6: 122,528,422	D162E	probably benign	Het
Mixl1	T	C	1: 180,696,958	I19V	probably benign	Het
Mtrr	G	T	13: 68,568,860	Y411*	probably null	Het
Myh7	T	C	14: 54,990,025	T318A	probably benign	Het
Nbeal1	T	A	1: 60,310,224	Y2348*	probably null	Het
Nlrc3	T	C	16: 3,963,590	S668G	probably damaging	Het
Nutm1	G	A	2: 112,250,056	R505C	probably damaging	Het
Olfr1129	T	A	2: 87,575,708	V208E	probably damaging	Het
Olfr1222	C	A	2: 89,124,836	R298S	probably benign	Het
Olfr527	A	T	7: 140,336,741	D293V	possibly damaging	Het
Pcna	A	G	2: 132,252,877	S54P	probably benign	Het
Pde6a	A	G	18: 61,258,293	T570A	probably damaging	Het
Phf21b	A	T	15: 84,855,717	M1K	probably null	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Prob1	A	G	18: 35,653,299	F634S	possibly damaging	Het
Prss50	A	G	9: 110,861,289	T167A	probably damaging	Het
Ptpn1	T	C	2: 167,974,772	V249A	probably damaging	Het
Rai1	G	A	11: 60,188,673	V1188I	probably benign	Het
Ric1	G	A	19: 29,584,578		probably null	Het
Robo1	C	T	16: 72,989,631	Q844*	probably null	Het
Rpn1	A	G	6: 88,084,637	D36G	possibly damaging	Het
Serpinb1b	A	T	13: 33,093,827	M348L	probably benign	Het
Setd4	T	C	16: 93,583,942		probably null	Het
Setd5	T	G	6: 113,147,557	S1124A	probably benign	Het
Slc35c1	C	A	2: 92,458,739	V154F	probably damaging	Het
Slc7a6os	G	T	8: 106,210,489	S113*	probably null	Het
Syne2	T	A	12: 76,103,036	D1787E	probably benign	Het
Tas2r144	A	C	6: 42,215,439	I38L	probably damaging	Het
Tepsin	G	T	11: 120,091,708	T512K	possibly damaging	Het
Utp20	A	G	10: 88,770,724	V1662A	probably benign	Het
Vmn1r201	C	T	13: 22,475,339	A241V	possibly damaging	Het
Vmn2r60	T	A	7: 42,136,402	S210T	probably benign	Het
Wdr6	G	T	9: 108,574,585	H700N	probably damaging	Het
Zdhhc8	T	C	16: 18,234,926	T29A	probably benign	Het
Zfp335	A	G	2: 164,900,132	I614T	probably damaging	Het
Zfp54	T	A	17: 21,433,582	S113T	probably benign	Het
Zfp873	T	A	10: 82,061,237	C601S	probably damaging	Het
Zfyve26	T	C	12: 79,278,372		probably null	Het
Zmynd8	T	C	2: 165,840,009	T201A	probably damaging	Het

Other mutations in L3mbtl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00905:L3mbtl3	APN	10	26313846	critical splice donor site	probably null
IGL01357:L3mbtl3	APN	10	26330185	missense	unknown
IGL01712:L3mbtl3	APN	10	26276235	missense	probably damaging	0.96
IGL01759:L3mbtl3	APN	10	26331900	missense	unknown
IGL01928:L3mbtl3	APN	10	26330245	missense	unknown
IGL01955:L3mbtl3	APN	10	26318438	missense	unknown
IGL02674:L3mbtl3	APN	10	26282813	missense	unknown
IGL02731:L3mbtl3	APN	10	26344176	critical splice donor site	probably null
IGL03188:L3mbtl3	APN	10	26342617	missense	unknown
IGL03252:L3mbtl3	APN	10	26331812	splice site	probably benign
IGL03298:L3mbtl3	APN	10	26282798	missense	unknown
IGL03400:L3mbtl3	APN	10	26315526	missense	unknown
R0121:L3mbtl3	UTSW	10	26313870	missense	unknown
R0468:L3mbtl3	UTSW	10	26327732	missense	unknown
R0497:L3mbtl3	UTSW	10	26282874	splice site	probably benign
R0586:L3mbtl3	UTSW	10	26327834	missense	unknown
R0633:L3mbtl3	UTSW	10	26302685	missense	unknown
R0679:L3mbtl3	UTSW	10	26313933	nonsense	probably null
R1302:L3mbtl3	UTSW	10	26327769	missense	unknown
R2128:L3mbtl3	UTSW	10	26313868	missense	unknown
R2267:L3mbtl3	UTSW	10	26331857	nonsense	probably null
R3121:L3mbtl3	UTSW	10	26344221	intron	probably benign
R3410:L3mbtl3	UTSW	10	26339299	missense	unknown
R4237:L3mbtl3	UTSW	10	26340948	missense	unknown
R4257:L3mbtl3	UTSW	10	26280122	missense	unknown
R4308:L3mbtl3	UTSW	10	26282792	missense	unknown
R4359:L3mbtl3	UTSW	10	26327741	missense	unknown
R4407:L3mbtl3	UTSW	10	26313884	missense	unknown
R4613:L3mbtl3	UTSW	10	26282795	missense	unknown
R4663:L3mbtl3	UTSW	10	26337817	missense	unknown
R4843:L3mbtl3	UTSW	10	26331879	missense	unknown
R4886:L3mbtl3	UTSW	10	26292770	missense	unknown
R5158:L3mbtl3	UTSW	10	26303688	missense	unknown
R5247:L3mbtl3	UTSW	10	26327808	missense	unknown
R5580:L3mbtl3	UTSW	10	26303706	missense	unknown
R5966:L3mbtl3	UTSW	10	26331864	missense	unknown
R6218:L3mbtl3	UTSW	10	26292747	missense	unknown
R6508:L3mbtl3	UTSW	10	26318427	missense	unknown
R6563:L3mbtl3	UTSW	10	26302863	splice site	probably null
R6709:L3mbtl3	UTSW	10	26282797	missense	unknown
R6927:L3mbtl3	UTSW	10	26292669	nonsense	probably null
R6984:L3mbtl3	UTSW	10	26282855	missense	unknown
R7010:L3mbtl3	UTSW	10	26282861	critical splice acceptor site	probably null
R7229:L3mbtl3	UTSW	10	26292662	missense	unknown
R7231:L3mbtl3	UTSW	10	26339282	missense	unknown
R7363:L3mbtl3	UTSW	10	26340952	missense	unknown
R7490:L3mbtl3	UTSW	10	26339231	missense	unknown
R7775:L3mbtl3	UTSW	10	26352317	missense	unknown
R7815:L3mbtl3	UTSW	10	26280378	missense	unknown
R8272:L3mbtl3	UTSW	10	26303668	missense	unknown
R8762:L3mbtl3	UTSW	10	26276223	missense	probably damaging	1.00
R8925:L3mbtl3	UTSW	10	26344186	missense	unknown
R8927:L3mbtl3	UTSW	10	26344186	missense	unknown
R9043:L3mbtl3	UTSW	10	26280254	missense	unknown
R9228:L3mbtl3	UTSW	10	26336257	missense	unknown
Z1177:L3mbtl3	UTSW	10	26280402	nonsense	probably null
Z1177:L3mbtl3	UTSW	10	26302663	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GTGGTATGGGAGAGTCAAACCC -3'
(R):5'- AGAAAGTGGGTTCTTAAGTCTGC -3'

Sequencing Primer
(F):5'- GAGAGTCAAACCCATTGTCCTATGG -3'
(R):5'- AAAGTGGGTTCTTAAGTCTGCTGTTG -3'

Posted On

2019-09-13