Incidental Mutation 'R7296:L3mbtl3'
ID571637
Institutional Source Beutler Lab
Gene Symbol L3mbtl3
Ensembl Gene ENSMUSG00000039089
Gene NameL3MBTL3 histone methyl-lysine binding protein
SynonymsMBT-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7296 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location26274468-26375971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26282830 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 615 (D615V)
Ref Sequence ENSEMBL: ENSMUSP00000101158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040219] [ENSMUST00000105519] [ENSMUST00000174766]
Predicted Effect unknown
Transcript: ENSMUST00000040219
AA Change: D640V
SMART Domains Protein: ENSMUSP00000037619
Gene: ENSMUSG00000039089
AA Change: D640V

DomainStartEndE-ValueType
low complexity region 154 166 N/A INTRINSIC
low complexity region 204 214 N/A INTRINSIC
MBT 232 332 3.75e-48 SMART
MBT 340 439 3.67e-42 SMART
MBT 448 543 7.5e-48 SMART
low complexity region 604 615 N/A INTRINSIC
low complexity region 662 770 N/A INTRINSIC
SAM 808 875 2.49e-13 SMART
Predicted Effect unknown
Transcript: ENSMUST00000105519
AA Change: D615V
SMART Domains Protein: ENSMUSP00000101158
Gene: ENSMUSG00000039089
AA Change: D615V

DomainStartEndE-ValueType
low complexity region 129 141 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
MBT 207 307 3.75e-48 SMART
MBT 315 414 3.67e-42 SMART
MBT 423 518 7.5e-48 SMART
low complexity region 579 590 N/A INTRINSIC
low complexity region 637 745 N/A INTRINSIC
SAM 783 850 2.49e-13 SMART
Predicted Effect unknown
Transcript: ENSMUST00000174766
AA Change: D640V
SMART Domains Protein: ENSMUSP00000133479
Gene: ENSMUSG00000039089
AA Change: D640V

DomainStartEndE-ValueType
low complexity region 154 166 N/A INTRINSIC
low complexity region 204 214 N/A INTRINSIC
MBT 232 332 3.75e-48 SMART
MBT 340 439 3.67e-42 SMART
MBT 448 543 7.5e-48 SMART
low complexity region 604 615 N/A INTRINSIC
low complexity region 662 770 N/A INTRINSIC
SAM 808 875 2.49e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the malignant brain tumor (MBT) family of chromatin interacting transcriptional repressors. Members of this family function as methyl-lysine readers, which recognize methylated lysine residues on histone protein tails, and are associated with the repression of gene expression. The encoded protein may regulate hematopoiesis. Homozygous deletion of this gene has been observed in human patients with medulloblastoma. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null mutation die between E17.5 ? 19.5 due to disturbed erythropoiesis which result in anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik T A 1: 57,383,143 M226K probably benign Het
2010300C02Rik T C 1: 37,614,618 T1036A possibly damaging Het
4921524L21Rik T G 18: 6,626,385 S132R probably damaging Het
A4gnt T G 9: 99,620,282 I165S probably damaging Het
Abca14 G A 7: 120,278,311 D1061N probably benign Het
Abcc9 G A 6: 142,671,593 P582S probably damaging Het
Abhd5 G A 9: 122,379,573 V343I probably benign Het
Adam6a C T 12: 113,545,572 R522C probably damaging Het
Ankle2 G A 5: 110,237,724 R313H probably damaging Het
Aplf G A 6: 87,646,215 T315I probably damaging Het
Arntl2 G A 6: 146,822,134 V321I not run Het
Asic5 C T 3: 82,021,076 P491S probably benign Het
Atp5b T C 10: 128,085,522 Y230H probably benign Het
B4galt6 A T 18: 20,728,042 I51N probably damaging Het
C4b A G 17: 34,743,659 L23S probably damaging Het
C77080 A G 4: 129,225,418 Y170H probably damaging Het
Cables2 A G 2: 180,260,336 V410A Het
Cdyl A G 13: 35,863,395 M489V probably damaging Het
Clip4 T C 17: 71,790,001 M40T probably damaging Het
Col12a1 T C 9: 79,682,066 Y1069C probably damaging Het
Col6a3 T C 1: 90,827,986 M194V probably benign Het
Colec11 T A 12: 28,594,715 D260V probably damaging Het
Cux2 T C 5: 121,861,256 D1207G probably benign Het
Cyp2d34 G T 15: 82,617,235 N297K possibly damaging Het
Dmbt1 A G 7: 131,112,132 Y1643C unknown Het
Dnmt3c A G 2: 153,715,026 T288A probably benign Het
Dock8 T A 19: 25,184,881 F1842I probably benign Het
Dysf A G 6: 84,106,898 I740V probably benign Het
Epha6 T A 16: 59,915,838 M778L probably benign Het
Eri2 A T 7: 119,786,516 L254* probably null Het
Fam129b T C 2: 32,922,642 S468P possibly damaging Het
Fam43b A G 4: 138,395,841 F56S probably damaging Het
Fat4 C A 3: 38,889,145 S729* probably null Het
Fbxw22 C A 9: 109,382,075 W386L probably benign Het
Fgd6 T A 10: 94,044,047 C254* probably null Het
Fgd6 C A 10: 94,139,881 T1386K probably benign Het
Fkbp7 G T 2: 76,671,764 D98E possibly damaging Het
Gm8251 T A 1: 44,060,916 K341* probably null Het
Hectd1 C T 12: 51,785,852 C913Y possibly damaging Het
Hgf T A 5: 16,564,843 M105K probably benign Het
Icam1 A C 9: 21,019,015 D55A probably benign Het
Itga2 A C 13: 114,857,394 probably null Het
Kcnj5 A C 9: 32,322,749 L90R probably damaging Het
Klra17 T A 6: 129,831,592 N226I possibly damaging Het
Krt1 T A 15: 101,850,629 R33S unknown Het
Lrp2 T A 2: 69,482,381 Y2521F probably benign Het
Megf10 A T 18: 57,275,753 N589I probably damaging Het
Metap1d G C 2: 71,506,785 G14A probably benign Het
Mfap5 T A 6: 122,528,422 D162E probably benign Het
Mixl1 T C 1: 180,696,958 I19V probably benign Het
Mtrr G T 13: 68,568,860 Y411* probably null Het
Myh7 T C 14: 54,990,025 T318A probably benign Het
Nbeal1 T A 1: 60,310,224 Y2348* probably null Het
Nlrc3 T C 16: 3,963,590 S668G probably damaging Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1129 T A 2: 87,575,708 V208E probably damaging Het
Olfr1222 C A 2: 89,124,836 R298S probably benign Het
Olfr527 A T 7: 140,336,741 D293V possibly damaging Het
Pcna A G 2: 132,252,877 S54P probably benign Het
Pde6a A G 18: 61,258,293 T570A probably damaging Het
Phf21b A T 15: 84,855,717 M1K probably null Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prob1 A G 18: 35,653,299 F634S possibly damaging Het
Prss50 A G 9: 110,861,289 T167A probably damaging Het
Ptpn1 T C 2: 167,974,772 V249A probably damaging Het
Rai1 G A 11: 60,188,673 V1188I probably benign Het
Ric1 G A 19: 29,584,578 probably null Het
Robo1 C T 16: 72,989,631 Q844* probably null Het
Rpn1 A G 6: 88,084,637 D36G possibly damaging Het
Serpinb1b A T 13: 33,093,827 M348L probably benign Het
Setd4 T C 16: 93,583,942 probably null Het
Setd5 T G 6: 113,147,557 S1124A probably benign Het
Slc35c1 C A 2: 92,458,739 V154F probably damaging Het
Slc7a6os G T 8: 106,210,489 S113* probably null Het
Syne2 T A 12: 76,103,036 D1787E probably benign Het
Tas2r144 A C 6: 42,215,439 I38L probably damaging Het
Tepsin G T 11: 120,091,708 T512K possibly damaging Het
Utp20 A G 10: 88,770,724 V1662A probably benign Het
Vmn1r201 C T 13: 22,475,339 A241V possibly damaging Het
Vmn2r60 T A 7: 42,136,402 S210T probably benign Het
Wdr6 G T 9: 108,574,585 H700N probably damaging Het
Zdhhc8 T C 16: 18,234,926 T29A probably benign Het
Zfp335 A G 2: 164,900,132 I614T probably damaging Het
Zfp54 T A 17: 21,433,582 S113T probably benign Het
Zfp873 T A 10: 82,061,237 C601S probably damaging Het
Zfyve26 T C 12: 79,278,372 probably null Het
Zmynd8 T C 2: 165,840,009 T201A probably damaging Het
Other mutations in L3mbtl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:L3mbtl3 APN 10 26313846 critical splice donor site probably null
IGL01357:L3mbtl3 APN 10 26330185 missense unknown
IGL01712:L3mbtl3 APN 10 26276235 missense probably damaging 0.96
IGL01759:L3mbtl3 APN 10 26331900 missense unknown
IGL01928:L3mbtl3 APN 10 26330245 missense unknown
IGL01955:L3mbtl3 APN 10 26318438 missense unknown
IGL02674:L3mbtl3 APN 10 26282813 missense unknown
IGL02731:L3mbtl3 APN 10 26344176 critical splice donor site probably null
IGL03188:L3mbtl3 APN 10 26342617 missense unknown
IGL03252:L3mbtl3 APN 10 26331812 splice site probably benign
IGL03298:L3mbtl3 APN 10 26282798 missense unknown
IGL03400:L3mbtl3 APN 10 26315526 missense unknown
R0121:L3mbtl3 UTSW 10 26313870 missense unknown
R0468:L3mbtl3 UTSW 10 26327732 missense unknown
R0497:L3mbtl3 UTSW 10 26282874 splice site probably benign
R0586:L3mbtl3 UTSW 10 26327834 missense unknown
R0633:L3mbtl3 UTSW 10 26302685 missense unknown
R0679:L3mbtl3 UTSW 10 26313933 nonsense probably null
R1302:L3mbtl3 UTSW 10 26327769 missense unknown
R2128:L3mbtl3 UTSW 10 26313868 missense unknown
R2267:L3mbtl3 UTSW 10 26331857 nonsense probably null
R3121:L3mbtl3 UTSW 10 26344221 intron probably benign
R3410:L3mbtl3 UTSW 10 26339299 missense unknown
R4237:L3mbtl3 UTSW 10 26340948 missense unknown
R4257:L3mbtl3 UTSW 10 26280122 missense unknown
R4308:L3mbtl3 UTSW 10 26282792 missense unknown
R4359:L3mbtl3 UTSW 10 26327741 missense unknown
R4407:L3mbtl3 UTSW 10 26313884 missense unknown
R4613:L3mbtl3 UTSW 10 26282795 missense unknown
R4663:L3mbtl3 UTSW 10 26337817 missense unknown
R4843:L3mbtl3 UTSW 10 26331879 missense unknown
R4886:L3mbtl3 UTSW 10 26292770 missense unknown
R5158:L3mbtl3 UTSW 10 26303688 missense unknown
R5247:L3mbtl3 UTSW 10 26327808 missense unknown
R5580:L3mbtl3 UTSW 10 26303706 missense unknown
R5966:L3mbtl3 UTSW 10 26331864 missense unknown
R6218:L3mbtl3 UTSW 10 26292747 missense unknown
R6508:L3mbtl3 UTSW 10 26318427 missense unknown
R6563:L3mbtl3 UTSW 10 26302863 intron probably null
R6709:L3mbtl3 UTSW 10 26282797 missense unknown
R6927:L3mbtl3 UTSW 10 26292669 nonsense probably null
R6984:L3mbtl3 UTSW 10 26282855 missense unknown
R7010:L3mbtl3 UTSW 10 26282861 critical splice acceptor site probably null
R7229:L3mbtl3 UTSW 10 26292662 missense unknown
R7231:L3mbtl3 UTSW 10 26339282 missense unknown
R7363:L3mbtl3 UTSW 10 26340952 missense unknown
R7490:L3mbtl3 UTSW 10 26339231 missense unknown
Predicted Primers PCR Primer
(F):5'- GTGGTATGGGAGAGTCAAACCC -3'
(R):5'- AGAAAGTGGGTTCTTAAGTCTGC -3'

Sequencing Primer
(F):5'- GAGAGTCAAACCCATTGTCCTATGG -3'
(R):5'- AAAGTGGGTTCTTAAGTCTGCTGTTG -3'
Posted On2019-09-13