Incidental Mutation 'R7296:Mtrr'
ID571652
Institutional Source Beutler Lab
Gene Symbol Mtrr
Ensembl Gene ENSMUSG00000034617
Gene Name5-methyltetrahydrofolate-homocysteine methyltransferase reductase
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_172480; MGI: 1891037

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7296 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location68560780-68582149 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 68568860 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 411 (Y411*)
Ref Sequence ENSEMBL: ENSMUSP00000039810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045827] [ENSMUST00000223101] [ENSMUST00000223398]
Predicted Effect probably null
Transcript: ENSMUST00000045827
AA Change: Y411*
SMART Domains Protein: ENSMUSP00000039810
Gene: ENSMUSG00000034617
AA Change: Y411*

DomainStartEndE-ValueType
Pfam:Flavodoxin_5 5 126 2.7e-9 PFAM
Pfam:Flavodoxin_1 6 142 4.3e-32 PFAM
Pfam:FAD_binding_1 267 490 2.6e-51 PFAM
Pfam:NAD_binding_1 540 660 5.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220544
Predicted Effect probably benign
Transcript: ENSMUST00000223101
Predicted Effect probably null
Transcript: ENSMUST00000223398
AA Change: Y411*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: Methionine is an essential amino acid required for protein synthesis and one-carbon metabolism. Its synthesis is catalyzed by the enzyme methionine synthase. Methionine synthase eventually becomes inactive due to the oxidation of its cob(I)alamin cofactor. The protein encoded by this gene regenerates a functional methionine synthase via reductive methylation. It is a member of the ferredoxin-NADP(+) reductase (FNR) family of electron transferases. Mutations in a similar gene in human have been associated with cblE complementation type homocystinuria-megaloblastic anemia and susceptibility to folate-sensitive neural tube defects. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele are viable and display a male-specific reduction in postnatal weight gain as well as hyperhomocysteinemia, hypomethionemia, increased tissue methyltetrahydrofolate, and AdoMet/AdoHcy ratios that range from high to slightly below normal. [provided by MGI curators]
Allele List at MGI

All alleles(46) : Gene trapped(46)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik T A 1: 57,383,143 M226K probably benign Het
2010300C02Rik T C 1: 37,614,618 T1036A possibly damaging Het
4921524L21Rik T G 18: 6,626,385 S132R probably damaging Het
A4gnt T G 9: 99,620,282 I165S probably damaging Het
Abca14 G A 7: 120,278,311 D1061N probably benign Het
Abcc9 G A 6: 142,671,593 P582S probably damaging Het
Abhd5 G A 9: 122,379,573 V343I probably benign Het
Adam6a C T 12: 113,545,572 R522C probably damaging Het
Ankle2 G A 5: 110,237,724 R313H probably damaging Het
Aplf G A 6: 87,646,215 T315I probably damaging Het
Arntl2 G A 6: 146,822,134 V321I not run Het
Asic5 C T 3: 82,021,076 P491S probably benign Het
Atp5b T C 10: 128,085,522 Y230H probably benign Het
B4galt6 A T 18: 20,728,042 I51N probably damaging Het
C4b A G 17: 34,743,659 L23S probably damaging Het
C77080 A G 4: 129,225,418 Y170H probably damaging Het
Cables2 A G 2: 180,260,336 V410A Het
Cdyl A G 13: 35,863,395 M489V probably damaging Het
Clip4 T C 17: 71,790,001 M40T probably damaging Het
Col12a1 T C 9: 79,682,066 Y1069C probably damaging Het
Col6a3 T C 1: 90,827,986 M194V probably benign Het
Colec11 T A 12: 28,594,715 D260V probably damaging Het
Cux2 T C 5: 121,861,256 D1207G probably benign Het
Cyp2d34 G T 15: 82,617,235 N297K possibly damaging Het
Dmbt1 A G 7: 131,112,132 Y1643C unknown Het
Dnmt3c A G 2: 153,715,026 T288A probably benign Het
Dock8 T A 19: 25,184,881 F1842I probably benign Het
Dysf A G 6: 84,106,898 I740V probably benign Het
Epha6 T A 16: 59,915,838 M778L probably benign Het
Eri2 A T 7: 119,786,516 L254* probably null Het
Fam129b T C 2: 32,922,642 S468P possibly damaging Het
Fam43b A G 4: 138,395,841 F56S probably damaging Het
Fat4 C A 3: 38,889,145 S729* probably null Het
Fbxw22 C A 9: 109,382,075 W386L probably benign Het
Fgd6 T A 10: 94,044,047 C254* probably null Het
Fgd6 C A 10: 94,139,881 T1386K probably benign Het
Fkbp7 G T 2: 76,671,764 D98E possibly damaging Het
Gm8251 T A 1: 44,060,916 K341* probably null Het
Hectd1 C T 12: 51,785,852 C913Y possibly damaging Het
Hgf T A 5: 16,564,843 M105K probably benign Het
Icam1 A C 9: 21,019,015 D55A probably benign Het
Itga2 A C 13: 114,857,394 probably null Het
Kcnj5 A C 9: 32,322,749 L90R probably damaging Het
Klra17 T A 6: 129,831,592 N226I possibly damaging Het
Krt1 T A 15: 101,850,629 R33S unknown Het
L3mbtl3 T A 10: 26,282,830 D615V unknown Het
Lrp2 T A 2: 69,482,381 Y2521F probably benign Het
Megf10 A T 18: 57,275,753 N589I probably damaging Het
Metap1d G C 2: 71,506,785 G14A probably benign Het
Mfap5 T A 6: 122,528,422 D162E probably benign Het
Mixl1 T C 1: 180,696,958 I19V probably benign Het
Myh7 T C 14: 54,990,025 T318A probably benign Het
Nbeal1 T A 1: 60,310,224 Y2348* probably null Het
Nlrc3 T C 16: 3,963,590 S668G probably damaging Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1129 T A 2: 87,575,708 V208E probably damaging Het
Olfr1222 C A 2: 89,124,836 R298S probably benign Het
Olfr527 A T 7: 140,336,741 D293V possibly damaging Het
Pcna A G 2: 132,252,877 S54P probably benign Het
Pde6a A G 18: 61,258,293 T570A probably damaging Het
Phf21b A T 15: 84,855,717 M1K probably null Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prob1 A G 18: 35,653,299 F634S possibly damaging Het
Prss50 A G 9: 110,861,289 T167A probably damaging Het
Ptpn1 T C 2: 167,974,772 V249A probably damaging Het
Rai1 G A 11: 60,188,673 V1188I probably benign Het
Ric1 G A 19: 29,584,578 probably null Het
Robo1 C T 16: 72,989,631 Q844* probably null Het
Rpn1 A G 6: 88,084,637 D36G possibly damaging Het
Serpinb1b A T 13: 33,093,827 M348L probably benign Het
Setd4 T C 16: 93,583,942 probably null Het
Setd5 T G 6: 113,147,557 S1124A probably benign Het
Slc35c1 C A 2: 92,458,739 V154F probably damaging Het
Slc7a6os G T 8: 106,210,489 S113* probably null Het
Syne2 T A 12: 76,103,036 D1787E probably benign Het
Tas2r144 A C 6: 42,215,439 I38L probably damaging Het
Tepsin G T 11: 120,091,708 T512K possibly damaging Het
Utp20 A G 10: 88,770,724 V1662A probably benign Het
Vmn1r201 C T 13: 22,475,339 A241V possibly damaging Het
Vmn2r60 T A 7: 42,136,402 S210T probably benign Het
Wdr6 G T 9: 108,574,585 H700N probably damaging Het
Zdhhc8 T C 16: 18,234,926 T29A probably benign Het
Zfp335 A G 2: 164,900,132 I614T probably damaging Het
Zfp54 T A 17: 21,433,582 S113T probably benign Het
Zfp873 T A 10: 82,061,237 C601S probably damaging Het
Zfyve26 T C 12: 79,278,372 probably null Het
Zmynd8 T C 2: 165,840,009 T201A probably damaging Het
Other mutations in Mtrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01787:Mtrr APN 13 68571147 missense probably damaging 1.00
IGL01806:Mtrr APN 13 68580600 missense possibly damaging 0.92
IGL01808:Mtrr APN 13 68566093 missense probably benign 0.00
IGL01875:Mtrr APN 13 68572609 missense probably damaging 1.00
IGL02137:Mtrr APN 13 68568801 missense possibly damaging 0.75
IGL02186:Mtrr APN 13 68564357 missense probably benign
IGL03114:Mtrr APN 13 68564322 nonsense probably null
3-1:Mtrr UTSW 13 68575016 critical splice donor site probably null
H8562:Mtrr UTSW 13 68564377 missense probably damaging 0.97
N/A:Mtrr UTSW 13 68575397 splice site probably benign
R0007:Mtrr UTSW 13 68575330 missense probably benign 0.02
R0741:Mtrr UTSW 13 68579539 splice site probably null
R2140:Mtrr UTSW 13 68568940 missense possibly damaging 0.47
R2513:Mtrr UTSW 13 68566973 nonsense probably null
R4604:Mtrr UTSW 13 68564512 splice site probably null
R5501:Mtrr UTSW 13 68579647 missense probably damaging 1.00
R5658:Mtrr UTSW 13 68568915 missense possibly damaging 0.67
R6477:Mtrr UTSW 13 68570073 missense probably damaging 1.00
R6694:Mtrr UTSW 13 68564333 missense probably benign
R6979:Mtrr UTSW 13 68570003 critical splice donor site probably null
R7094:Mtrr UTSW 13 68579684 missense possibly damaging 0.83
R7354:Mtrr UTSW 13 68566207 missense probably damaging 1.00
R7378:Mtrr UTSW 13 68564402 missense probably damaging 1.00
R7546:Mtrr UTSW 13 68582149 unclassified probably benign
R7562:Mtrr UTSW 13 68566217 missense probably damaging 0.96
R7759:Mtrr UTSW 13 68570027 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGCCGGCCTTCTTCACTATG -3'
(R):5'- TACTGCGATAGTCTTTGTACAGG -3'

Sequencing Primer
(F):5'- TCACTATGCAGAGGCTCACTAAAGTG -3'
(R):5'- ACAAGCTCTCACCCTGTAACTGTG -3'
Posted On2019-09-13