Mutagenetix > Incidental Mutation

Incidental Mutation 'R7296:C4b'

571662

Institutional Source

Beutler Lab

Gene Symbol

C4b

Ensembl Gene

ENSMUSG00000073418

Gene Name

complement component 4B (Chido blood group)

Synonyms

C4, Ss

MMRRC Submission

045400-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7296 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34728380-34743882 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34743659 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 23 (L23S)

Ref Sequence

ENSEMBL: ENSMUSP00000069418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069507]

AlphaFold

P01029

Predicted Effect

probably damaging
Transcript: ENSMUST00000069507
AA Change: L23S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: L23S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:A2M_N	138	231	2e-19	PFAM
A2M_N_2	470	609	2.87e-26	SMART
ANATO	700	734	3.58e-12	SMART
low complexity region	761	771	N/A	INTRINSIC
A2M	779	867	1.46e-27	SMART
Pfam:Thiol-ester_cl	995	1024	7.7e-13	PFAM
Pfam:A2M_comp	1047	1313	1.3e-82	PFAM
low complexity region	1441	1447	N/A	INTRINSIC
A2M_recep	1475	1564	1.03e-36	SMART
C345C	1608	1720	5.69e-40	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.8%

Validation Efficiency

98% (85/87)

MGI Phenotype

PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700066M21Rik	T	A	1: 57,383,143	M226K	probably benign	Het
2010300C02Rik	T	C	1: 37,614,618	T1036A	possibly damaging	Het
4921524L21Rik	T	G	18: 6,626,385	S132R	probably damaging	Het
A4gnt	T	G	9: 99,620,282	I165S	probably damaging	Het
Abca14	G	A	7: 120,278,311	D1061N	probably benign	Het
Abcc9	G	A	6: 142,671,593	P582S	probably damaging	Het
Abhd5	G	A	9: 122,379,573	V343I	probably benign	Het
Adam6a	C	T	12: 113,545,572	R522C	probably damaging	Het
Ankle2	G	A	5: 110,237,724	R313H	probably damaging	Het
Aplf	G	A	6: 87,646,215	T315I	probably damaging	Het
Arntl2	G	A	6: 146,822,134	V321I	not run	Het
Asic5	C	T	3: 82,021,076	P491S	probably benign	Het
Atp5b	T	C	10: 128,085,522	Y230H	probably benign	Het
B4galt6	A	T	18: 20,728,042	I51N	probably damaging	Het
C77080	A	G	4: 129,225,418	Y170H	probably damaging	Het
Cables2	A	G	2: 180,260,336	V410A		Het
Cdyl	A	G	13: 35,863,395	M489V	probably damaging	Het
Clip4	T	C	17: 71,790,001	M40T	probably damaging	Het
Col12a1	T	C	9: 79,682,066	Y1069C	probably damaging	Het
Col6a3	T	C	1: 90,827,986	M194V	probably benign	Het
Colec11	T	A	12: 28,594,715	D260V	probably damaging	Het
Cux2	T	C	5: 121,861,256	D1207G	probably benign	Het
Cyp2d34	G	T	15: 82,617,235	N297K	possibly damaging	Het
Dmbt1	A	G	7: 131,112,132	Y1643C	unknown	Het
Dnmt3c	A	G	2: 153,715,026	T288A	probably benign	Het
Dock8	T	A	19: 25,184,881	F1842I	probably benign	Het
Dysf	A	G	6: 84,106,898	I740V	probably benign	Het
Epha6	T	A	16: 59,915,838	M778L	probably benign	Het
Eri2	A	T	7: 119,786,516	L254*	probably null	Het
Fam129b	T	C	2: 32,922,642	S468P	possibly damaging	Het
Fam43b	A	G	4: 138,395,841	F56S	probably damaging	Het
Fat4	C	A	3: 38,889,145	S729*	probably null	Het
Fbxw22	C	A	9: 109,382,075	W386L	probably benign	Het
Fgd6	T	A	10: 94,044,047	C254*	probably null	Het
Fgd6	C	A	10: 94,139,881	T1386K	probably benign	Het
Fkbp7	G	T	2: 76,671,764	D98E	possibly damaging	Het
Gm8251	T	A	1: 44,060,916	K341*	probably null	Het
Hectd1	C	T	12: 51,785,852	C913Y	possibly damaging	Het
Hgf	T	A	5: 16,564,843	M105K	probably benign	Het
Icam1	A	C	9: 21,019,015	D55A	probably benign	Het
Itga2	A	C	13: 114,857,394		probably null	Het
Kcnj5	A	C	9: 32,322,749	L90R	probably damaging	Het
Klra17	T	A	6: 129,831,592	N226I	possibly damaging	Het
Krt1	T	A	15: 101,850,629	R33S	unknown	Het
L3mbtl3	T	A	10: 26,282,830	D615V	unknown	Het
Lrp2	T	A	2: 69,482,381	Y2521F	probably benign	Het
Megf10	A	T	18: 57,275,753	N589I	probably damaging	Het
Metap1d	G	C	2: 71,506,785	G14A	probably benign	Het
Mfap5	T	A	6: 122,528,422	D162E	probably benign	Het
Mixl1	T	C	1: 180,696,958	I19V	probably benign	Het
Mtrr	G	T	13: 68,568,860	Y411*	probably null	Het
Myh7	T	C	14: 54,990,025	T318A	probably benign	Het
Nbeal1	T	A	1: 60,310,224	Y2348*	probably null	Het
Nlrc3	T	C	16: 3,963,590	S668G	probably damaging	Het
Nutm1	G	A	2: 112,250,056	R505C	probably damaging	Het
Olfr1129	T	A	2: 87,575,708	V208E	probably damaging	Het
Olfr1222	C	A	2: 89,124,836	R298S	probably benign	Het
Olfr527	A	T	7: 140,336,741	D293V	possibly damaging	Het
Pcna	A	G	2: 132,252,877	S54P	probably benign	Het
Pde6a	A	G	18: 61,258,293	T570A	probably damaging	Het
Phf21b	A	T	15: 84,855,717	M1K	probably null	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Prob1	A	G	18: 35,653,299	F634S	possibly damaging	Het
Prss50	A	G	9: 110,861,289	T167A	probably damaging	Het
Ptpn1	T	C	2: 167,974,772	V249A	probably damaging	Het
Rai1	G	A	11: 60,188,673	V1188I	probably benign	Het
Ric1	G	A	19: 29,584,578		probably null	Het
Robo1	C	T	16: 72,989,631	Q844*	probably null	Het
Rpn1	A	G	6: 88,084,637	D36G	possibly damaging	Het
Serpinb1b	A	T	13: 33,093,827	M348L	probably benign	Het
Setd4	T	C	16: 93,583,942		probably null	Het
Setd5	T	G	6: 113,147,557	S1124A	probably benign	Het
Slc35c1	C	A	2: 92,458,739	V154F	probably damaging	Het
Slc7a6os	G	T	8: 106,210,489	S113*	probably null	Het
Syne2	T	A	12: 76,103,036	D1787E	probably benign	Het
Tas2r144	A	C	6: 42,215,439	I38L	probably damaging	Het
Tepsin	G	T	11: 120,091,708	T512K	possibly damaging	Het
Utp20	A	G	10: 88,770,724	V1662A	probably benign	Het
Vmn1r201	C	T	13: 22,475,339	A241V	possibly damaging	Het
Vmn2r60	T	A	7: 42,136,402	S210T	probably benign	Het
Wdr6	G	T	9: 108,574,585	H700N	probably damaging	Het
Zdhhc8	T	C	16: 18,234,926	T29A	probably benign	Het
Zfp335	A	G	2: 164,900,132	I614T	probably damaging	Het
Zfp54	T	A	17: 21,433,582	S113T	probably benign	Het
Zfp873	T	A	10: 82,061,237	C601S	probably damaging	Het
Zfyve26	T	C	12: 79,278,372		probably null	Het
Zmynd8	T	C	2: 165,840,009	T201A	probably damaging	Het

Other mutations in C4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:C4b	APN	17	34734428	missense	probably damaging	1.00
IGL00433:C4b	APN	17	34742041	missense	possibly damaging	0.75
IGL00471:C4b	APN	17	34734429	missense	probably damaging	1.00
IGL00515:C4b	APN	17	34728891	missense	probably damaging	1.00
IGL01599:C4b	APN	17	34743019	splice site	probably benign
IGL01761:C4b	APN	17	34739938	missense	possibly damaging	0.56
IGL02004:C4b	APN	17	34739010	unclassified	probably benign
IGL02215:C4b	APN	17	34734491	missense	probably damaging	1.00
IGL02517:C4b	APN	17	34734408	missense	probably benign	0.01
IGL02926:C4b	APN	17	34730712	missense	possibly damaging	0.95
IGL03031:C4b	APN	17	34731130	missense	possibly damaging	0.47
IGL03057:C4b	APN	17	34737764	unclassified	probably benign
IGL03165:C4b	APN	17	34739955	missense	probably benign	0.13
IGL03380:C4b	APN	17	34740286	missense	probably benign	0.01
Aspiration	UTSW	17	34734442	missense	probably benign	0.00
Inspiration	UTSW	17	34732166	splice site	probably null
Peroration	UTSW	17	34729399	critical splice donor site	probably null
perspiration	UTSW	17	34729831	missense	probably damaging	1.00
FR4548:C4b	UTSW	17	34740997	missense	probably benign	0.00
PIT4142001:C4b	UTSW	17	34733701	missense	probably benign	0.01
R0064:C4b	UTSW	17	34738856	missense	probably damaging	1.00
R0113:C4b	UTSW	17	34741240	missense	probably damaging	0.98
R0143:C4b	UTSW	17	34734219	unclassified	probably benign
R0254:C4b	UTSW	17	34734776	missense	probably benign	0.00
R0320:C4b	UTSW	17	34733161	missense	probably benign	0.01
R0391:C4b	UTSW	17	34735614	splice site	probably benign
R0399:C4b	UTSW	17	34728869	missense	probably damaging	1.00
R0467:C4b	UTSW	17	34736127	missense	probably benign	0.01
R0549:C4b	UTSW	17	34735415	missense	probably damaging	1.00
R0561:C4b	UTSW	17	34734417	missense	probably damaging	0.99
R0662:C4b	UTSW	17	34730888	missense	probably damaging	1.00
R0941:C4b	UTSW	17	34740055	missense	probably benign
R1161:C4b	UTSW	17	34729593	missense	probably damaging	1.00
R1169:C4b	UTSW	17	34742972	missense	probably benign	0.14
R1186:C4b	UTSW	17	34736309	missense	possibly damaging	0.47
R1310:C4b	UTSW	17	34729593	missense	probably damaging	1.00
R1398:C4b	UTSW	17	34730719	unclassified	probably benign
R1472:C4b	UTSW	17	34743769	nonsense	probably null
R1496:C4b	UTSW	17	34740021	missense	probably benign	0.30
R1544:C4b	UTSW	17	34738967	missense	probably benign	0.13
R1588:C4b	UTSW	17	34741025	missense	probably benign
R1645:C4b	UTSW	17	34740597	missense	probably damaging	1.00
R1664:C4b	UTSW	17	34732978	missense	probably damaging	1.00
R1678:C4b	UTSW	17	34743650	missense	probably benign	0.05
R1710:C4b	UTSW	17	34743664	splice site	probably benign
R1713:C4b	UTSW	17	34729271	splice site	probably benign
R1770:C4b	UTSW	17	34736927	missense	possibly damaging	0.78
R1859:C4b	UTSW	17	34735553	missense	probably benign
R1924:C4b	UTSW	17	34729657	missense	probably damaging	1.00
R2057:C4b	UTSW	17	34728620	missense	probably damaging	1.00
R2060:C4b	UTSW	17	34736101	missense	probably damaging	1.00
R2184:C4b	UTSW	17	34737702	missense	probably benign	0.27
R2306:C4b	UTSW	17	34728518	missense	probably benign	0.00
R2363:C4b	UTSW	17	34736058	splice site	probably benign
R2365:C4b	UTSW	17	34736058	splice site	probably benign
R2379:C4b	UTSW	17	34735743	missense	possibly damaging	0.81
R2860:C4b	UTSW	17	34734758	missense	probably damaging	0.99
R2861:C4b	UTSW	17	34734758	missense	probably damaging	0.99
R3551:C4b	UTSW	17	34741872	missense	possibly damaging	0.75
R3765:C4b	UTSW	17	34729840	missense	probably damaging	0.98
R4157:C4b	UTSW	17	34742855	missense	probably damaging	1.00
R4299:C4b	UTSW	17	34731144	missense	possibly damaging	0.52
R4365:C4b	UTSW	17	34734743	missense	possibly damaging	0.65
R4411:C4b	UTSW	17	34728864	missense	probably damaging	1.00
R4613:C4b	UTSW	17	34734551	missense	probably benign	0.12
R4784:C4b	UTSW	17	34733406	missense	probably benign	0.00
R4790:C4b	UTSW	17	34734143	missense	probably benign	0.01
R4831:C4b	UTSW	17	34736890	splice site	probably null
R4879:C4b	UTSW	17	34743647	missense	probably damaging	0.99
R5036:C4b	UTSW	17	34740445	critical splice acceptor site	probably null
R5361:C4b	UTSW	17	34741238	missense	probably benign	0.15
R5384:C4b	UTSW	17	34737661	missense	possibly damaging	0.89
R5518:C4b	UTSW	17	34734442	missense	probably benign	0.00
R5590:C4b	UTSW	17	34740335	missense	probably damaging	0.98
R5643:C4b	UTSW	17	34742417	missense	probably benign	0.01
R5644:C4b	UTSW	17	34742417	missense	probably benign	0.01
R5833:C4b	UTSW	17	34730673	missense	probably damaging	1.00
R5931:C4b	UTSW	17	34729193	missense	probably damaging	0.99
R6178:C4b	UTSW	17	34733406	missense	probably benign	0.00
R6209:C4b	UTSW	17	34741087	missense	possibly damaging	0.93
R6225:C4b	UTSW	17	34738874	missense	possibly damaging	0.64
R6518:C4b	UTSW	17	34734205	missense	probably damaging	0.98
R6613:C4b	UTSW	17	34733565	missense	probably damaging	0.99
R6781:C4b	UTSW	17	34742954	missense	probably damaging	0.99
R6807:C4b	UTSW	17	34730956	missense	probably benign	0.17
R6858:C4b	UTSW	17	34729831	missense	probably damaging	1.00
R6962:C4b	UTSW	17	34732166	splice site	probably null
R7068:C4b	UTSW	17	34733477	missense	probably damaging	1.00
R7081:C4b	UTSW	17	34735443	missense	probably benign	0.27
R7105:C4b	UTSW	17	34730911	missense	possibly damaging	0.52
R7211:C4b	UTSW	17	34735534	missense	possibly damaging	0.92
R7314:C4b	UTSW	17	34740356	missense	probably benign
R7330:C4b	UTSW	17	34730472	missense	probably damaging	1.00
R7397:C4b	UTSW	17	34742390	missense	possibly damaging	0.80
R7437:C4b	UTSW	17	34734733	missense	probably benign	0.10
R7490:C4b	UTSW	17	34731080	nonsense	probably null
R7597:C4b	UTSW	17	34739675	missense	probably benign
R7633:C4b	UTSW	17	34729399	critical splice donor site	probably null
R7900:C4b	UTSW	17	34739777	missense	probably benign	0.03
R7910:C4b	UTSW	17	34740352	missense	probably benign	0.00
R7923:C4b	UTSW	17	34742380	missense	probably damaging	1.00
R7960:C4b	UTSW	17	34741278	splice site	probably null
R8420:C4b	UTSW	17	34734539	missense	probably damaging	0.97
R8467:C4b	UTSW	17	34732813	missense	possibly damaging	0.51
R8558:C4b	UTSW	17	34736567	missense	probably damaging	1.00
R8725:C4b	UTSW	17	34734485	missense	probably damaging	1.00
R8727:C4b	UTSW	17	34734485	missense	probably damaging	1.00
R8853:C4b	UTSW	17	34729905	missense	possibly damaging	0.91
R8934:C4b	UTSW	17	34732984	missense	possibly damaging	0.78
R8944:C4b	UTSW	17	34742939	missense	probably benign	0.00
R8960:C4b	UTSW	17	34733918	missense	probably damaging	1.00
R8982:C4b	UTSW	17	34734364	critical splice donor site	probably null
R9104:C4b	UTSW	17	34729259	missense	probably benign	0.39
R9114:C4b	UTSW	17	34729430	missense	probably damaging	0.99
R9348:C4b	UTSW	17	34733185	missense	probably benign	0.01
R9428:C4b	UTSW	17	34730911	missense	possibly damaging	0.52
R9533:C4b	UTSW	17	34737724	nonsense	probably null
R9591:C4b	UTSW	17	34738955	missense	probably benign	0.00
R9678:C4b	UTSW	17	34741789	critical splice donor site	probably null
Z1176:C4b	UTSW	17	34731147	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- AAGTCATCTCCCGAGCTCAG -3'
(R):5'- AACCCTAGGTTGATCAGAAGGG -3'

Sequencing Primer
(F):5'- TCCCGAGCTCAGCTTAAAGTC -3'
(R):5'- TGAATCCTCCAGCCATGCG -3'

Posted On

2019-09-13