Mutagenetix > Incidental Mutations

Incidental Mutation 'R7296:Dock8'

571669

Institutional Source

Beutler Lab

Gene Symbol

Dock8

Ensembl Gene

ENSMUSG00000052085

Gene Name

dedicator of cytokinesis 8

Synonyms

A130095G14Rik, 5830472H07Rik, 1200017A24Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R7296 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24999529-25202432 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 25184881 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 1842 (F1842I)

Ref Sequence

ENSEMBL: ENSMUSP00000025831 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025831]

AlphaFold

Q8C147

PDB Structure

Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000025831
AA Change: F1842I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: F1842I

Domain	Start	End	E-Value	Type
Pfam:DUF3398	71	164	3.9e-25	PFAM
Pfam:DOCK-C2	557	739	6.7e-49	PFAM
low complexity region	786	803	N/A	INTRINSIC
low complexity region	1003	1020	N/A	INTRINSIC
low complexity region	1123	1138	N/A	INTRINSIC
low complexity region	1236	1246	N/A	INTRINSIC
low complexity region	1371	1383	N/A	INTRINSIC
Pfam:DHR-2	1534	2060	5e-210	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.8%

Validation Efficiency

98% (85/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700066M21Rik	T	A	1: 57,383,143	M226K	probably benign	Het
2010300C02Rik	T	C	1: 37,614,618	T1036A	possibly damaging	Het
4921524L21Rik	T	G	18: 6,626,385	S132R	probably damaging	Het
A4gnt	T	G	9: 99,620,282	I165S	probably damaging	Het
Abca14	G	A	7: 120,278,311	D1061N	probably benign	Het
Abcc9	G	A	6: 142,671,593	P582S	probably damaging	Het
Abhd5	G	A	9: 122,379,573	V343I	probably benign	Het
Adam6a	C	T	12: 113,545,572	R522C	probably damaging	Het
Ankle2	G	A	5: 110,237,724	R313H	probably damaging	Het
Aplf	G	A	6: 87,646,215	T315I	probably damaging	Het
Arntl2	G	A	6: 146,822,134	V321I	not run	Het
Asic5	C	T	3: 82,021,076	P491S	probably benign	Het
Atp5b	T	C	10: 128,085,522	Y230H	probably benign	Het
B4galt6	A	T	18: 20,728,042	I51N	probably damaging	Het
C4b	A	G	17: 34,743,659	L23S	probably damaging	Het
C77080	A	G	4: 129,225,418	Y170H	probably damaging	Het
Cables2	A	G	2: 180,260,336	V410A		Het
Cdyl	A	G	13: 35,863,395	M489V	probably damaging	Het
Clip4	T	C	17: 71,790,001	M40T	probably damaging	Het
Col12a1	T	C	9: 79,682,066	Y1069C	probably damaging	Het
Col6a3	T	C	1: 90,827,986	M194V	probably benign	Het
Colec11	T	A	12: 28,594,715	D260V	probably damaging	Het
Cux2	T	C	5: 121,861,256	D1207G	probably benign	Het
Cyp2d34	G	T	15: 82,617,235	N297K	possibly damaging	Het
Dmbt1	A	G	7: 131,112,132	Y1643C	unknown	Het
Dnmt3c	A	G	2: 153,715,026	T288A	probably benign	Het
Dysf	A	G	6: 84,106,898	I740V	probably benign	Het
Epha6	T	A	16: 59,915,838	M778L	probably benign	Het
Eri2	A	T	7: 119,786,516	L254*	probably null	Het
Fam129b	T	C	2: 32,922,642	S468P	possibly damaging	Het
Fam43b	A	G	4: 138,395,841	F56S	probably damaging	Het
Fat4	C	A	3: 38,889,145	S729*	probably null	Het
Fbxw22	C	A	9: 109,382,075	W386L	probably benign	Het
Fgd6	C	A	10: 94,139,881	T1386K	probably benign	Het
Fgd6	T	A	10: 94,044,047	C254*	probably null	Het
Fkbp7	G	T	2: 76,671,764	D98E	possibly damaging	Het
Gm8251	T	A	1: 44,060,916	K341*	probably null	Het
Hectd1	C	T	12: 51,785,852	C913Y	possibly damaging	Het
Hgf	T	A	5: 16,564,843	M105K	probably benign	Het
Icam1	A	C	9: 21,019,015	D55A	probably benign	Het
Itga2	A	C	13: 114,857,394		probably null	Het
Kcnj5	A	C	9: 32,322,749	L90R	probably damaging	Het
Klra17	T	A	6: 129,831,592	N226I	possibly damaging	Het
Krt1	T	A	15: 101,850,629	R33S	unknown	Het
L3mbtl3	T	A	10: 26,282,830	D615V	unknown	Het
Lrp2	T	A	2: 69,482,381	Y2521F	probably benign	Het
Megf10	A	T	18: 57,275,753	N589I	probably damaging	Het
Metap1d	G	C	2: 71,506,785	G14A	probably benign	Het
Mfap5	T	A	6: 122,528,422	D162E	probably benign	Het
Mixl1	T	C	1: 180,696,958	I19V	probably benign	Het
Mtrr	G	T	13: 68,568,860	Y411*	probably null	Het
Myh7	T	C	14: 54,990,025	T318A	probably benign	Het
Nbeal1	T	A	1: 60,310,224	Y2348*	probably null	Het
Nlrc3	T	C	16: 3,963,590	S668G	probably damaging	Het
Nutm1	G	A	2: 112,250,056	R505C	probably damaging	Het
Olfr1129	T	A	2: 87,575,708	V208E	probably damaging	Het
Olfr1222	C	A	2: 89,124,836	R298S	probably benign	Het
Olfr527	A	T	7: 140,336,741	D293V	possibly damaging	Het
Pcna	A	G	2: 132,252,877	S54P	probably benign	Het
Pde6a	A	G	18: 61,258,293	T570A	probably damaging	Het
Phf21b	A	T	15: 84,855,717	M1K	probably null	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Prob1	A	G	18: 35,653,299	F634S	possibly damaging	Het
Prss50	A	G	9: 110,861,289	T167A	probably damaging	Het
Ptpn1	T	C	2: 167,974,772	V249A	probably damaging	Het
Rai1	G	A	11: 60,188,673	V1188I	probably benign	Het
Ric1	G	A	19: 29,584,578		probably null	Het
Robo1	C	T	16: 72,989,631	Q844*	probably null	Het
Rpn1	A	G	6: 88,084,637	D36G	possibly damaging	Het
Serpinb1b	A	T	13: 33,093,827	M348L	probably benign	Het
Setd4	T	C	16: 93,583,942		probably null	Het
Setd5	T	G	6: 113,147,557	S1124A	probably benign	Het
Slc35c1	C	A	2: 92,458,739	V154F	probably damaging	Het
Slc7a6os	G	T	8: 106,210,489	S113*	probably null	Het
Syne2	T	A	12: 76,103,036	D1787E	probably benign	Het
Tas2r144	A	C	6: 42,215,439	I38L	probably damaging	Het
Tepsin	G	T	11: 120,091,708	T512K	possibly damaging	Het
Utp20	A	G	10: 88,770,724	V1662A	probably benign	Het
Vmn1r201	C	T	13: 22,475,339	A241V	possibly damaging	Het
Vmn2r60	T	A	7: 42,136,402	S210T	probably benign	Het
Wdr6	G	T	9: 108,574,585	H700N	probably damaging	Het
Zdhhc8	T	C	16: 18,234,926	T29A	probably benign	Het
Zfp335	A	G	2: 164,900,132	I614T	probably damaging	Het
Zfp54	T	A	17: 21,433,582	S113T	probably benign	Het
Zfp873	T	A	10: 82,061,237	C601S	probably damaging	Het
Zfyve26	T	C	12: 79,278,372		probably null	Het
Zmynd8	T	C	2: 165,840,009	T201A	probably damaging	Het

Other mutations in Dock8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
captain_morgan	APN	19	25127711	critical splice donor site	probably benign
primurus	APN	19	25183609	missense	probably damaging	1.00
IGL00737:Dock8	APN	19	25182976	missense	probably benign	0.00
IGL00755:Dock8	APN	19	25051509	missense	probably benign	0.09
IGL00822:Dock8	APN	19	25188409	nonsense	probably null
IGL00838:Dock8	APN	19	25175459	nonsense	probably null
IGL01419:Dock8	APN	19	25119452	missense	probably benign	0.08
IGL01456:Dock8	APN	19	25119499	missense	possibly damaging	0.95
IGL01532:Dock8	APN	19	25169441	missense	probably damaging	0.99
IGL01602:Dock8	APN	19	25089888	splice site	probably benign
IGL01605:Dock8	APN	19	25089888	splice site	probably benign
IGL01753:Dock8	APN	19	25061292	splice site	probably benign
IGL01843:Dock8	APN	19	25089928	missense	probably benign	0.02
IGL02032:Dock8	APN	19	25130405	missense	probably damaging	0.99
IGL02073:Dock8	APN	19	25200986	critical splice acceptor site	probably null
IGL02192:Dock8	APN	19	25078205	critical splice donor site	probably null
IGL02402:Dock8	APN	19	25078145	missense	probably benign	0.25
IGL02529:Dock8	APN	19	25100926	nonsense	probably null
IGL02728:Dock8	APN	19	25132220	missense	probably benign
IGL02739:Dock8	APN	19	25188488	missense	probably damaging	1.00
IGL03037:Dock8	APN	19	25086181	missense	probably benign	0.02
IGL03104:Dock8	APN	19	25201020	nonsense	probably null
IGL03137:Dock8	APN	19	25155948	missense	probably benign	0.19
IGL03365:Dock8	APN	19	25099684	missense	possibly damaging	0.70
Defenseless	UTSW	19	25051563	missense	probably benign	0.00
Guardate	UTSW	19	25149831	missense	probably benign
hillock	UTSW	19	25174333	critical splice donor site	probably null
Molehill	UTSW	19	25130461	missense	probably damaging	1.00
Pap	UTSW	19	25122441	missense	probably benign	0.31
Papilla	UTSW	19	25078084	nonsense	probably null
snowdrop	UTSW	19	25184941	critical splice donor site	probably null
warts_and_all	UTSW	19	25169501	critical splice donor site	probably null
R0021:Dock8	UTSW	19	25163047	missense	probably benign	0.01
R0147:Dock8	UTSW	19	25119459	missense	probably benign	0.00
R0148:Dock8	UTSW	19	25119459	missense	probably benign	0.00
R0294:Dock8	UTSW	19	25188350	missense	probably damaging	1.00
R0537:Dock8	UTSW	19	25171577	missense	probably benign	0.08
R0630:Dock8	UTSW	19	25061160	missense	probably benign	0.10
R1163:Dock8	UTSW	19	25051503	missense	probably benign
R1164:Dock8	UTSW	19	25090027	missense	probably benign	0.44
R1471:Dock8	UTSW	19	25201036	missense	possibly damaging	0.74
R1477:Dock8	UTSW	19	25095550	missense	possibly damaging	0.95
R1633:Dock8	UTSW	19	25051563	missense	probably benign	0.00
R1803:Dock8	UTSW	19	25132235	missense	probably benign	0.00
R1822:Dock8	UTSW	19	25161058	missense	probably benign	0.31
R1852:Dock8	UTSW	19	25127128	missense	probably benign	0.45
R1916:Dock8	UTSW	19	25061157	missense	probably benign	0.02
R1984:Dock8	UTSW	19	25121181	missense	probably null	0.95
R2311:Dock8	UTSW	19	25183004	missense	possibly damaging	0.93
R2341:Dock8	UTSW	19	25200393	missense	probably damaging	0.99
R2483:Dock8	UTSW	19	25079877	missense	probably benign
R3116:Dock8	UTSW	19	25188494	missense	probably benign	0.00
R3157:Dock8	UTSW	19	25149831	missense	probably benign
R3623:Dock8	UTSW	19	25079877	missense	probably benign
R3624:Dock8	UTSW	19	25079877	missense	probably benign
R3800:Dock8	UTSW	19	25164352	missense	probably benign	0.08
R3844:Dock8	UTSW	19	25065430	nonsense	probably null
R3895:Dock8	UTSW	19	25051501	missense	probably benign	0.31
R3901:Dock8	UTSW	19	25100905	missense	possibly damaging	0.69
R3959:Dock8	UTSW	19	25184941	critical splice donor site	probably null
R4428:Dock8	UTSW	19	25200499	missense	probably damaging	0.98
R4428:Dock8	UTSW	19	25065390	missense	probably benign	0.00
R4429:Dock8	UTSW	19	25065390	missense	probably benign	0.00
R4431:Dock8	UTSW	19	25065390	missense	probably benign	0.00
R4545:Dock8	UTSW	19	25188358	missense	probably damaging	1.00
R4839:Dock8	UTSW	19	25169494	missense	probably benign	0.00
R4897:Dock8	UTSW	19	25181637	missense	probably benign	0.00
R4939:Dock8	UTSW	19	25122400	missense	probably damaging	1.00
R4995:Dock8	UTSW	19	25158383	missense	probably benign	0.02
R5035:Dock8	UTSW	19	25086207	missense	probably damaging	0.99
R5294:Dock8	UTSW	19	25061153	missense	probably benign	0.01
R5324:Dock8	UTSW	19	25163094	missense	probably benign	0.17
R5478:Dock8	UTSW	19	25079822	missense	probably benign
R5704:Dock8	UTSW	19	25174222	missense	probably damaging	1.00
R5724:Dock8	UTSW	19	25122421	missense	probably damaging	1.00
R5745:Dock8	UTSW	19	25130397	missense	probably benign	0.02
R5864:Dock8	UTSW	19	25061220	missense	probably damaging	0.99
R5870:Dock8	UTSW	19	25132126	missense	probably benign
R5893:Dock8	UTSW	19	25122447	missense	probably damaging	1.00
R5954:Dock8	UTSW	19	25171619	missense	probably damaging	1.00
R6087:Dock8	UTSW	19	25161074	missense	probably benign	0.00
R6223:Dock8	UTSW	19	25161052	missense	probably benign	0.00
R6391:Dock8	UTSW	19	25095550	missense	possibly damaging	0.95
R6759:Dock8	UTSW	19	25127484	missense	probably damaging	0.99
R6786:Dock8	UTSW	19	25183022	missense	possibly damaging	0.49
R6794:Dock8	UTSW	19	25122441	missense	probably benign	0.31
R6818:Dock8	UTSW	19	25169501	critical splice donor site	probably null
R6885:Dock8	UTSW	19	25147378	missense	possibly damaging	0.95
R6908:Dock8	UTSW	19	25188382	missense	probably damaging	1.00
R6923:Dock8	UTSW	19	25095606	missense	probably benign
R7001:Dock8	UTSW	19	25099677	missense	probably benign
R7141:Dock8	UTSW	19	25181620	missense	probably null	0.75
R7203:Dock8	UTSW	19	25181563	missense	probably damaging	1.00
R7257:Dock8	UTSW	19	25127085	missense	probably benign	0.08
R7538:Dock8	UTSW	19	25158418	missense	probably damaging	1.00
R7555:Dock8	UTSW	19	25175400	missense	probably damaging	0.99
R7641:Dock8	UTSW	19	25174333	critical splice donor site	probably null
R7764:Dock8	UTSW	19	25097535	missense	probably benign
R7859:Dock8	UTSW	19	25183570	missense	probably damaging	1.00
R7864:Dock8	UTSW	19	25163500	missense	possibly damaging	0.95
R8090:Dock8	UTSW	19	25154242	missense	probably damaging	1.00
R8160:Dock8	UTSW	19	25147347	missense	probably damaging	1.00
R8287:Dock8	UTSW	19	25130461	missense	probably damaging	1.00
R8295:Dock8	UTSW	19	25123236	missense	probably benign	0.04
R8443:Dock8	UTSW	19	25155917	missense	probably benign	0.04
R8537:Dock8	UTSW	19	25130506	missense	probably benign	0.00
R8673:Dock8	UTSW	19	25183503	missense	probably damaging	0.96
R8709:Dock8	UTSW	19	25078084	nonsense	probably null
R8834:Dock8	UTSW	19	25163470	missense	probably benign	0.16
R8991:Dock8	UTSW	19	25188367	missense	possibly damaging	0.82
X0027:Dock8	UTSW	19	25161129	missense	probably benign
Z1177:Dock8	UTSW	19	25132123	missense	probably benign	0.05
Z1177:Dock8	UTSW	19	25155972	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- CAGTGTGCTGAACTTCCTTAGAC -3'
(R):5'- AAGAGTGAGCCTGCACACAC -3'

Sequencing Primer
(F):5'- AGACTTTCATTTCTGGTTTAGGAAG -3'
(R):5'- GCATACACTCCATTCATACATGTGTG -3'

Posted On

2019-09-13