Incidental Mutation 'R7365:Dnah7a'
ID571673
Institutional Source Beutler Lab
Gene Symbol Dnah7a
Ensembl Gene ENSMUSG00000096141
Gene Namedynein, axonemal, heavy chain 7A
SynonymsDnahc7a, Dnahc7, LOC381341
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R7365 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location53397006-53706784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53497138 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 2582 (M2582K)
Ref Sequence ENSEMBL: ENSMUSP00000092571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094964]
Predicted Effect probably benign
Transcript: ENSMUST00000094964
AA Change: M2582K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092571
Gene: ENSMUSG00000096141
AA Change: M2582K

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
coiled coil region 504 537 N/A INTRINSIC
Pfam:DHC_N2 756 1165 3.1e-149 PFAM
AAA 1320 1459 2.46e-1 SMART
Blast:AAA 1601 1879 1e-87 BLAST
AAA 1968 2116 5.39e-2 SMART
Pfam:AAA_8 2303 2574 6.9e-75 PFAM
Pfam:MT 2586 2936 2.1e-55 PFAM
Pfam:AAA_9 2957 3182 1.3e-98 PFAM
Pfam:Dynein_heavy 3318 4020 2.3e-287 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,562,936 S155G probably benign Het
Abcc4 T C 14: 118,627,654 N320S probably damaging Het
Akr1c19 G A 13: 4,237,070 R96H probably benign Het
Ankrd17 T C 5: 90,291,151 D451G possibly damaging Het
Ano8 T A 8: 71,485,110 D36V probably damaging Het
Aqp3 A G 4: 41,098,003 V36A probably benign Het
Atf7ip A G 6: 136,560,710 T314A probably benign Het
Atp2c1 A T 9: 105,422,999 D700E probably damaging Het
Axin2 G A 11: 108,939,376 V341M possibly damaging Het
Bin3 A G 14: 70,134,527 Q139R probably damaging Het
Brca2 A G 5: 150,532,337 D181G probably damaging Het
C330027C09Rik T A 16: 49,001,653 S215T probably benign Het
Capn3 A G 2: 120,494,814 E466G probably damaging Het
Ccdc14 T A 16: 34,723,619 Y830* probably null Het
Cdk12 T C 11: 98,221,084 F723L unknown Het
Clca2 T A 3: 145,098,784 I61F probably damaging Het
Clca4b T C 3: 144,922,768 T393A not run Het
Cldn5 G A 16: 18,777,095 A34T probably damaging Het
Cobll1 A T 2: 65,098,373 S870T probably damaging Het
Col12a1 T C 9: 79,706,360 K68E probably damaging Het
Crnn A T 3: 93,148,534 Q209L probably damaging Het
Cwf19l1 A T 19: 44,132,140 F45I probably damaging Het
Cyfip2 T A 11: 46,207,440 K1052* probably null Het
Dcc G A 18: 71,826,123 P193S probably damaging Het
Dda1 T A 8: 71,474,493 C48S probably benign Het
Disc1 A G 8: 125,155,041 R572G probably damaging Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Dynlrb2 T C 8: 116,514,957 V80A probably benign Het
Eif3a A T 19: 60,766,644 D1033E unknown Het
Enam C A 5: 88,501,488 H285Q possibly damaging Het
Ep400 T C 5: 110,719,614 D980G unknown Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Erc2 A C 14: 28,040,389 D703A probably damaging Het
Ezh2 G T 6: 47,533,758 S639* probably null Het
Fbn1 G A 2: 125,352,049 H1333Y probably damaging Het
Flad1 A G 3: 89,408,665 S197P possibly damaging Het
Gfm2 G T 13: 97,143,021 C26F probably benign Het
Gm5294 A G 5: 138,820,981 H82R probably damaging Het
Gm597 A T 1: 28,780,152 M16K probably benign Het
Golga2 C T 2: 32,303,001 Q444* probably null Het
Gp5 A T 16: 30,308,608 V416D probably damaging Het
Gpr137c A G 14: 45,279,014 D353G probably damaging Het
Hoxa13 A C 6: 52,259,882 W133G probably damaging Het
Hydin A T 8: 110,557,662 I3189F probably damaging Het
Hydin A T 8: 110,601,273 K4804M probably damaging Het
Ice2 T C 9: 69,400,512 F26S probably damaging Het
Ipo5 A G 14: 120,920,085 I112V probably benign Het
Itgax T A 7: 128,135,309 S346R probably damaging Het
Kcnj13 T A 1: 87,389,017 M125L probably damaging Het
Lmbrd1 T A 1: 24,744,867 V359E possibly damaging Het
Lrrc7 T G 3: 158,198,161 K287N probably damaging Het
Mau2 C T 8: 70,029,234 A191T possibly damaging Het
Mkx C A 18: 7,000,747 R65L possibly damaging Het
Mroh4 T A 15: 74,610,371 K746* probably null Het
Myh4 A G 11: 67,242,848 T238A probably damaging Het
Nlrp9c T A 7: 26,371,397 N920Y possibly damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Ntn4 T C 10: 93,644,804 L130P probably damaging Het
Olfr1240 A G 2: 89,440,198 V27A probably benign Het
Olfr1312 A T 2: 112,043,014 V6E possibly damaging Het
Olfr682-ps1 T A 7: 105,128,345 I21F probably benign Het
Olfr695 A G 7: 106,713,964 V239A probably benign Het
Olfr930 A T 9: 38,930,776 I202F probably damaging Het
Otog T C 7: 46,298,308 L110P probably damaging Het
Plcxd2 T C 16: 45,980,426 E145G probably damaging Het
Pltp A T 2: 164,854,322 N143K probably damaging Het
Pnpt1 T C 11: 29,161,334 Y735H probably damaging Het
Prom1 A G 5: 44,020,831 Y520H probably damaging Het
Rag2 A G 2: 101,630,773 Y476C probably damaging Het
Rdh16f2 A G 10: 127,877,024 Y297C probably damaging Het
Ryr1 T C 7: 29,085,755 E1844G probably benign Het
Ryr2 A G 13: 11,640,275 C3679R probably damaging Het
Sirt1 A G 10: 63,322,003 I544T probably benign Het
Slc26a10 A T 10: 127,176,847 I382N possibly damaging Het
Sox2 C A 3: 34,650,972 P186Q possibly damaging Het
Tnpo3 A G 6: 29,556,996 L752P probably damaging Het
Top2b T A 14: 16,416,649 N1136K probably benign Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Ttf2 C A 3: 100,963,302 D152Y possibly damaging Het
Txndc15 T C 13: 55,714,788 L4P unknown Het
Unc5a T C 13: 54,996,573 V237A possibly damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vav3 C A 3: 109,628,099 P616T possibly damaging Het
Vmn2r15 T A 5: 109,293,239 D251V probably benign Het
Vmn2r15 A G 5: 109,297,522 L12S probably benign Het
Wfs1 A C 5: 36,967,732 I605S probably benign Het
Wif1 G A 10: 121,083,909 R187Q possibly damaging Het
Zdhhc20 G T 14: 57,873,920 F74L possibly damaging Het
Zfp507 T C 7: 35,776,418 T303A unknown Het
Zfp763 A T 17: 33,033,378 probably benign Het
Other mutations in Dnah7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Dnah7a APN 1 53419684 missense probably damaging 0.99
IGL00510:Dnah7a APN 1 53501542 missense probably damaging 1.00
IGL00545:Dnah7a APN 1 53457746 missense possibly damaging 0.87
IGL01320:Dnah7a APN 1 53434046 missense probably benign 0.32
IGL01322:Dnah7a APN 1 53434046 missense probably benign 0.32
IGL01357:Dnah7a APN 1 53662381 missense probably benign
IGL01417:Dnah7a APN 1 53584600 missense probably benign 0.01
IGL01508:Dnah7a APN 1 53627072 missense probably benign 0.00
IGL01511:Dnah7a APN 1 53419595 missense probably damaging 1.00
IGL01545:Dnah7a APN 1 53518782 missense probably benign
IGL01575:Dnah7a APN 1 53427820 splice site probably benign
IGL01667:Dnah7a APN 1 53547292 missense probably damaging 1.00
IGL01712:Dnah7a APN 1 53423270 missense probably benign 0.23
IGL01824:Dnah7a APN 1 53504270 missense probably benign
IGL01829:Dnah7a APN 1 53618068 missense possibly damaging 0.64
IGL01861:Dnah7a APN 1 53640349 missense probably benign 0.01
IGL01861:Dnah7a APN 1 53584449 splice site probably benign
IGL01984:Dnah7a APN 1 53702015 splice site probably null
IGL02056:Dnah7a APN 1 53504342 missense probably benign 0.17
IGL02069:Dnah7a APN 1 53561894 splice site probably benign
IGL02072:Dnah7a APN 1 53605827 missense probably damaging 1.00
IGL02110:Dnah7a APN 1 53411580 missense possibly damaging 0.52
IGL02120:Dnah7a APN 1 53495717 missense possibly damaging 0.46
IGL02128:Dnah7a APN 1 53437513 missense probably damaging 1.00
IGL02135:Dnah7a APN 1 53623473 missense probably benign 0.01
IGL02151:Dnah7a APN 1 53472864 missense probably benign 0.08
IGL02156:Dnah7a APN 1 53419723 missense probably benign 0.27
IGL02270:Dnah7a APN 1 53472893 missense possibly damaging 0.93
IGL02282:Dnah7a APN 1 53643510 missense possibly damaging 0.93
IGL02328:Dnah7a APN 1 53524937 critical splice donor site probably null
IGL02370:Dnah7a APN 1 53635397 missense probably benign 0.00
IGL02420:Dnah7a APN 1 53686543 missense probably benign
IGL02458:Dnah7a APN 1 53618328 nonsense probably null
IGL02489:Dnah7a APN 1 53647322 missense possibly damaging 0.94
IGL02554:Dnah7a APN 1 53618046 missense possibly damaging 0.93
IGL02578:Dnah7a APN 1 53432915 missense probably benign 0.00
IGL02646:Dnah7a APN 1 53525035 missense probably damaging 0.99
IGL02675:Dnah7a APN 1 53504024 missense possibly damaging 0.96
IGL02688:Dnah7a APN 1 53444472 missense possibly damaging 0.93
IGL02858:Dnah7a APN 1 53472959 splice site probably benign
IGL02874:Dnah7a APN 1 53605814 missense possibly damaging 0.70
IGL02887:Dnah7a APN 1 53522360 missense possibly damaging 0.46
IGL02894:Dnah7a APN 1 53577328 missense probably benign 0.27
IGL02926:Dnah7a APN 1 53495950 missense possibly damaging 0.64
IGL03113:Dnah7a APN 1 53433004 missense possibly damaging 0.64
IGL03156:Dnah7a APN 1 53605824 missense probably damaging 0.97
IGL03195:Dnah7a APN 1 53419607 missense probably damaging 1.00
IGL03209:Dnah7a APN 1 53686614 splice site probably benign
IGL03214:Dnah7a APN 1 53522209 critical splice donor site probably null
IGL03242:Dnah7a APN 1 53620723 missense probably benign 0.02
IGL03251:Dnah7a APN 1 53647274 missense probably benign
IGL03265:Dnah7a APN 1 53528848 missense probably benign
IGL03277:Dnah7a APN 1 53630322 missense probably benign 0.00
IGL03278:Dnah7a APN 1 53496965 missense probably benign 0.07
IGL03356:Dnah7a APN 1 53503934 missense probably benign 0.01
PIT4378001:Dnah7a UTSW 1 53531203 missense probably damaging 0.99
R0046:Dnah7a UTSW 1 53456874 splice site probably null
R0051:Dnah7a UTSW 1 53521086 splice site probably benign
R0082:Dnah7a UTSW 1 53518708 missense probably damaging 1.00
R0111:Dnah7a UTSW 1 53468684 missense probably benign 0.03
R0122:Dnah7a UTSW 1 53397142 missense probably damaging 1.00
R0245:Dnah7a UTSW 1 53501526 missense probably damaging 1.00
R0278:Dnah7a UTSW 1 53504146 missense probably benign 0.00
R0309:Dnah7a UTSW 1 53405690 missense probably damaging 0.97
R0334:Dnah7a UTSW 1 53433054 missense possibly damaging 0.61
R0392:Dnah7a UTSW 1 53504198 missense probably damaging 0.97
R0452:Dnah7a UTSW 1 53605819 missense probably benign 0.00
R0511:Dnah7a UTSW 1 53497126 missense probably benign
R0576:Dnah7a UTSW 1 53636087 missense probably benign 0.12
R0592:Dnah7a UTSW 1 53456612 missense possibly damaging 0.91
R0628:Dnah7a UTSW 1 53497105 missense probably benign 0.18
R0689:Dnah7a UTSW 1 53620681 nonsense probably null
R0735:Dnah7a UTSW 1 53544511 missense possibly damaging 0.70
R0800:Dnah7a UTSW 1 53565696 missense probably damaging 1.00
R0829:Dnah7a UTSW 1 53504079 missense probably benign 0.07
R0842:Dnah7a UTSW 1 53501674 missense possibly damaging 0.88
R0879:Dnah7a UTSW 1 53427860 missense possibly damaging 0.85
R1331:Dnah7a UTSW 1 53468669 missense probably damaging 0.99
R1418:Dnah7a UTSW 1 53647236 splice site probably benign
R1421:Dnah7a UTSW 1 53540873 splice site probably benign
R1445:Dnah7a UTSW 1 53528797 missense probably benign 0.02
R1473:Dnah7a UTSW 1 53496014 missense probably benign 0.00
R1538:Dnah7a UTSW 1 53495989 missense possibly damaging 0.71
R1742:Dnah7a UTSW 1 53456684 missense probably benign 0.39
R1754:Dnah7a UTSW 1 53504185 missense probably benign 0.18
R1754:Dnah7a UTSW 1 53561900 critical splice donor site probably null
R1773:Dnah7a UTSW 1 53432887 splice site probably null
R1779:Dnah7a UTSW 1 53577223 missense probably benign
R1816:Dnah7a UTSW 1 53631742 splice site probably benign
R1817:Dnah7a UTSW 1 53559148 missense probably benign
R1818:Dnah7a UTSW 1 53559148 missense probably benign
R1819:Dnah7a UTSW 1 53559148 missense probably benign
R1873:Dnah7a UTSW 1 53456532 splice site probably benign
R1875:Dnah7a UTSW 1 53456532 splice site probably benign
R1884:Dnah7a UTSW 1 53541000 missense probably damaging 0.99
R1902:Dnah7a UTSW 1 53535478 missense probably damaging 1.00
R1903:Dnah7a UTSW 1 53535478 missense probably damaging 1.00
R1908:Dnah7a UTSW 1 53631562 missense probably benign
R1959:Dnah7a UTSW 1 53684983 missense probably benign 0.00
R1960:Dnah7a UTSW 1 53684983 missense probably benign 0.00
R1985:Dnah7a UTSW 1 53503934 missense probably benign 0.01
R1992:Dnah7a UTSW 1 53582676 missense possibly damaging 0.91
R2037:Dnah7a UTSW 1 53582582 missense probably benign 0.00
R2074:Dnah7a UTSW 1 53457696 missense probably benign 0.45
R2076:Dnah7a UTSW 1 53503809 missense probably benign 0.01
R2124:Dnah7a UTSW 1 53496942 missense possibly damaging 0.58
R2191:Dnah7a UTSW 1 53605875 missense possibly damaging 0.54
R2211:Dnah7a UTSW 1 53479773 missense probably benign 0.21
R2220:Dnah7a UTSW 1 53521174 missense probably benign
R2355:Dnah7a UTSW 1 53582502 missense probably benign 0.00
R2495:Dnah7a UTSW 1 53605881 missense probably damaging 1.00
R2901:Dnah7a UTSW 1 53427872 missense probably damaging 0.99
R2911:Dnah7a UTSW 1 53427824 critical splice donor site probably null
R2993:Dnah7a UTSW 1 53503554 missense probably damaging 1.00
R3522:Dnah7a UTSW 1 53618116 missense probably damaging 1.00
R3683:Dnah7a UTSW 1 53444516 missense probably benign
R3723:Dnah7a UTSW 1 53447346 missense probably benign 0.04
R3847:Dnah7a UTSW 1 53501656 missense probably benign 0.01
R4002:Dnah7a UTSW 1 53631681 missense probably benign
R4009:Dnah7a UTSW 1 53525005 missense probably damaging 1.00
R4063:Dnah7a UTSW 1 53425217 missense probably benign
R4193:Dnah7a UTSW 1 53447334 missense probably benign 0.00
R4236:Dnah7a UTSW 1 53447365 missense probably benign 0.00
R4399:Dnah7a UTSW 1 53518727 missense probably damaging 1.00
R4469:Dnah7a UTSW 1 53444526 missense probably benign 0.01
R4494:Dnah7a UTSW 1 53449038 missense probably benign 0.01
R4569:Dnah7a UTSW 1 53411659 missense probably benign 0.01
R4609:Dnah7a UTSW 1 53456657 missense possibly damaging 0.80
R4632:Dnah7a UTSW 1 53427951 missense probably damaging 0.97
R4703:Dnah7a UTSW 1 53447317 critical splice donor site probably null
R4781:Dnah7a UTSW 1 53425208 missense probably benign 0.28
R4854:Dnah7a UTSW 1 53706729 utr 5 prime probably benign
R4932:Dnah7a UTSW 1 53503578 missense possibly damaging 0.90
R4976:Dnah7a UTSW 1 53698692 missense probably benign
R5000:Dnah7a UTSW 1 53567042 missense probably damaging 1.00
R5023:Dnah7a UTSW 1 53647248 nonsense probably null
R5026:Dnah7a UTSW 1 53662498 missense probably damaging 0.99
R5050:Dnah7a UTSW 1 53497096 missense probably benign 0.01
R5119:Dnah7a UTSW 1 53698692 missense probably benign
R5151:Dnah7a UTSW 1 53620770 missense probably benign 0.00
R5155:Dnah7a UTSW 1 53643495 missense probably benign 0.01
R5180:Dnah7a UTSW 1 53423287 missense probably damaging 0.97
R5228:Dnah7a UTSW 1 53437609 critical splice acceptor site probably null
R5237:Dnah7a UTSW 1 53447531 intron probably null
R5267:Dnah7a UTSW 1 53479692 missense probably damaging 1.00
R5334:Dnah7a UTSW 1 53503646 missense probably benign 0.00
R5358:Dnah7a UTSW 1 53547172 missense probably damaging 1.00
R5401:Dnah7a UTSW 1 53631653 missense probably benign 0.01
R5412:Dnah7a UTSW 1 53635344 missense probably benign
R5496:Dnah7a UTSW 1 53457768 missense probably benign
R5531:Dnah7a UTSW 1 53419748 missense possibly damaging 0.50
R5536:Dnah7a UTSW 1 53425253 missense probably benign
R5543:Dnah7a UTSW 1 53504069 missense probably damaging 1.00
R5597:Dnah7a UTSW 1 53534452 missense probably benign 0.00
R5609:Dnah7a UTSW 1 53582594 missense probably benign 0.03
R5643:Dnah7a UTSW 1 53405707 missense probably benign
R5644:Dnah7a UTSW 1 53540979 missense probably benign 0.33
R5689:Dnah7a UTSW 1 53405698 missense possibly damaging 0.87
R5715:Dnah7a UTSW 1 53413778 missense probably damaging 1.00
R5780:Dnah7a UTSW 1 53483319 missense probably benign 0.03
R5893:Dnah7a UTSW 1 53457785 missense possibly damaging 0.66
R5946:Dnah7a UTSW 1 53559308 missense probably damaging 1.00
R5995:Dnah7a UTSW 1 53620670 missense probably benign 0.00
R6102:Dnah7a UTSW 1 53559140 missense probably benign 0.00
R6108:Dnah7a UTSW 1 53456845 missense probably damaging 1.00
R6133:Dnah7a UTSW 1 53419655 missense probably benign 0.05
R6168:Dnah7a UTSW 1 53411568 missense probably damaging 1.00
R6175:Dnah7a UTSW 1 53433022 missense probably damaging 1.00
R6211:Dnah7a UTSW 1 53419636 missense probably damaging 0.99
R6282:Dnah7a UTSW 1 53503601 missense probably damaging 1.00
R6329:Dnah7a UTSW 1 53541114 missense probably damaging 1.00
R6344:Dnah7a UTSW 1 53397190 missense probably benign 0.02
R6530:Dnah7a UTSW 1 53503697 missense probably benign 0.04
R6574:Dnah7a UTSW 1 53456534 critical splice donor site probably null
R6608:Dnah7a UTSW 1 53525118 missense probably benign
R6625:Dnah7a UTSW 1 53565757 missense probably benign 0.05
R6661:Dnah7a UTSW 1 53623450 missense probably benign 0.00
R6681:Dnah7a UTSW 1 53521226 critical splice acceptor site probably null
R6747:Dnah7a UTSW 1 53636062 missense probably benign 0.01
R6774:Dnah7a UTSW 1 53698651 missense probably benign
R6823:Dnah7a UTSW 1 53456704 missense probably benign
R6900:Dnah7a UTSW 1 53662351 missense probably damaging 0.97
R6940:Dnah7a UTSW 1 53631677 missense probably benign 0.09
R6956:Dnah7a UTSW 1 53577287 missense probably benign 0.02
R6978:Dnah7a UTSW 1 53662367 missense probably null
R6988:Dnah7a UTSW 1 53582625 missense possibly damaging 0.62
R7026:Dnah7a UTSW 1 53504289 missense probably benign
R7027:Dnah7a UTSW 1 53631506 missense probably benign 0.01
R7033:Dnah7a UTSW 1 53479661 missense probably damaging 1.00
R7072:Dnah7a UTSW 1 53419753 missense probably benign 0.00
R7096:Dnah7a UTSW 1 53483440 missense possibly damaging 0.90
R7142:Dnah7a UTSW 1 53413768 nonsense probably null
R7144:Dnah7a UTSW 1 53698708 splice site probably null
R7167:Dnah7a UTSW 1 53503776 missense probably benign 0.00
R7182:Dnah7a UTSW 1 53620461 intron probably null
R7196:Dnah7a UTSW 1 53684841 missense probably benign 0.00
R7206:Dnah7a UTSW 1 53698633 nonsense probably null
R7215:Dnah7a UTSW 1 53618350 missense probably damaging 0.99
R7224:Dnah7a UTSW 1 53397261 missense probably benign 0.00
R7264:Dnah7a UTSW 1 53518814 missense probably benign
R7282:Dnah7a UTSW 1 53684900 critical splice acceptor site probably null
R7392:Dnah7a UTSW 1 53501661 missense probably benign 0.00
R7454:Dnah7a UTSW 1 53518764 missense probably benign
R7471:Dnah7a UTSW 1 53419699 missense probably damaging 1.00
R7547:Dnah7a UTSW 1 53663837 missense probably benign 0.00
R7554:Dnah7a UTSW 1 53528698 missense possibly damaging 0.87
R7655:Dnah7a UTSW 1 53496005 missense possibly damaging 0.50
R7656:Dnah7a UTSW 1 53496005 missense possibly damaging 0.50
R7666:Dnah7a UTSW 1 53547297 missense probably benign 0.00
R7721:Dnah7a UTSW 1 53631683 missense probably benign
X0027:Dnah7a UTSW 1 53472930 missense probably damaging 1.00
Z1088:Dnah7a UTSW 1 53468643 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTTGGCCACCTCCATTG -3'
(R):5'- GACCGAAAGTTATGACTGATTGGTC -3'

Sequencing Primer
(F):5'- GGCCACCTCCATTGACTCTC -3'
(R):5'- CAGAATGCCTCTTGATGC -3'
Posted On2019-09-13