Incidental Mutation 'R7365:Lrrc7'
ID571691
Institutional Source Beutler Lab
Gene Symbol Lrrc7
Ensembl Gene ENSMUSG00000028176
Gene Nameleucine rich repeat containing 7
Synonymsdensin
MMRRC Submission
Accession Numbers

Genbank: NM_001081358; MGI: 2676665

Is this an essential gene? Possibly essential (E-score: 0.749) question?
Stock #R7365 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location158082891-158562221 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 158198161 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 287 (K287N)
Ref Sequence ENSEMBL: ENSMUSP00000142498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106044] [ENSMUST00000199890] [ENSMUST00000200137]
Predicted Effect possibly damaging
Transcript: ENSMUST00000106044
AA Change: K287N

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101659
Gene: ENSMUSG00000028176
AA Change: K287N

DomainStartEndE-ValueType
LRR 53 73 3.65e0 SMART
LRR 96 118 2.2e1 SMART
LRR 142 164 4.21e1 SMART
LRR 165 187 7.36e0 SMART
LRR 188 210 7.05e-1 SMART
LRR 211 233 3.09e1 SMART
LRR 234 257 4.21e1 SMART
LRR 258 279 2.61e2 SMART
LRR 280 303 3.52e-1 SMART
LRR 326 349 1.99e0 SMART
LRR 372 394 2.63e0 SMART
low complexity region 466 476 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
Blast:PDZ 708 736 1e-5 BLAST
low complexity region 787 797 N/A INTRINSIC
low complexity region 864 878 N/A INTRINSIC
Blast:PDZ 1349 1378 2e-11 BLAST
PDZ 1460 1540 1.33e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199890
AA Change: K287N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142440
Gene: ENSMUSG00000028176
AA Change: K287N

DomainStartEndE-ValueType
LRR 53 73 3.65e0 SMART
LRR 96 118 2.2e1 SMART
LRR 142 164 4.21e1 SMART
LRR 165 187 7.36e0 SMART
LRR 188 210 7.05e-1 SMART
LRR 211 233 3.09e1 SMART
LRR 234 257 4.21e1 SMART
LRR 258 279 2.61e2 SMART
LRR 280 303 3.52e-1 SMART
LRR 326 349 1.99e0 SMART
LRR 372 394 2.63e0 SMART
low complexity region 466 476 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
Blast:PDZ 708 736 9e-6 BLAST
low complexity region 787 797 N/A INTRINSIC
low complexity region 864 878 N/A INTRINSIC
Blast:PDZ 1328 1364 1e-15 BLAST
low complexity region 1374 1387 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200137
AA Change: K287N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142498
Gene: ENSMUSG00000028176
AA Change: K287N

DomainStartEndE-ValueType
LRR 52 69 7.6e-1 SMART
LRR 73 92 4.2e-1 SMART
LRR 96 115 3.4e-1 SMART
LRR 142 164 1.8e-1 SMART
LRR 165 184 1.5e-1 SMART
LRR 188 207 2e-2 SMART
LRR 211 233 1.3e-1 SMART
LRR 234 257 1.7e-1 SMART
LRR 257 276 1e0 SMART
LRR 280 299 3.1e-2 SMART
LRR 303 322 6.6e-1 SMART
LRR 326 345 2.1e-1 SMART
LRR 372 391 1.2e-1 SMART
low complexity region 466 476 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
Blast:PDZ 708 736 1e-5 BLAST
low complexity region 787 797 N/A INTRINSIC
low complexity region 864 878 N/A INTRINSIC
Blast:PDZ 1302 1331 2e-11 BLAST
PDZ 1413 1493 6.4e-22 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (96/96)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit limb grasping, reduced long term depression, increased anxiety, increased aggression towards other mice, impaired spatial memory, decreased prepulse inhibition, decreased nesting building behavior, and abnormal dendritic spines. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,562,936 S155G probably benign Het
Abcc4 T C 14: 118,627,654 N320S probably damaging Het
Akr1c19 G A 13: 4,237,070 R96H probably benign Het
Ankrd17 T C 5: 90,291,151 D451G possibly damaging Het
Ano8 T A 8: 71,485,110 D36V probably damaging Het
Aqp3 A G 4: 41,098,003 V36A probably benign Het
Atf7ip A G 6: 136,560,710 T314A probably benign Het
Atp2c1 A T 9: 105,422,999 D700E probably damaging Het
Axin2 G A 11: 108,939,376 V341M possibly damaging Het
Bin3 A G 14: 70,134,527 Q139R probably damaging Het
Brca2 A G 5: 150,532,337 D181G probably damaging Het
C330027C09Rik T A 16: 49,001,653 S215T probably benign Het
Capn3 A G 2: 120,494,814 E466G probably damaging Het
Ccdc14 T A 16: 34,723,619 Y830* probably null Het
Cdk12 T C 11: 98,221,084 F723L unknown Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Clca2 T A 3: 145,098,784 I61F probably damaging Het
Clca4b T C 3: 144,922,768 T393A not run Het
Cldn5 G A 16: 18,777,095 A34T probably damaging Het
Cobll1 A T 2: 65,098,373 S870T probably damaging Het
Col12a1 T C 9: 79,706,360 K68E probably damaging Het
Crnn A T 3: 93,148,534 Q209L probably damaging Het
Cwf19l1 A T 19: 44,132,140 F45I probably damaging Het
Cyfip2 T A 11: 46,207,440 K1052* probably null Het
D930020B18Rik G A 10: 121,667,811 probably null Het
Dcc G A 18: 71,826,123 P193S probably damaging Het
Dda1 T A 8: 71,474,493 C48S probably benign Het
Disc1 A G 8: 125,155,041 R572G probably damaging Het
Dnah7a A T 1: 53,497,138 M2582K probably benign Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Dynlrb2 T C 8: 116,514,957 V80A probably benign Het
Eif3a A T 19: 60,766,644 D1033E unknown Het
Enam C A 5: 88,501,488 H285Q possibly damaging Het
Ep400 T C 5: 110,719,614 D980G unknown Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Erc2 A C 14: 28,040,389 D703A probably damaging Het
Ezh2 G T 6: 47,533,758 S639* probably null Het
Fbn1 G A 2: 125,352,049 H1333Y probably damaging Het
Flad1 A G 3: 89,408,665 S197P possibly damaging Het
Gfm2 G T 13: 97,143,021 C26F probably benign Het
Gm5294 A G 5: 138,820,981 H82R probably damaging Het
Gm597 A T 1: 28,780,152 M16K probably benign Het
Golga2 C T 2: 32,303,001 Q444* probably null Het
Gp5 A T 16: 30,308,608 V416D probably damaging Het
Gpat2 A G 2: 127,426,981 probably null Het
Gpr137c A G 14: 45,279,014 D353G probably damaging Het
Hoxa13 A C 6: 52,259,882 W133G probably damaging Het
Hydin A T 8: 110,557,662 I3189F probably damaging Het
Hydin A T 8: 110,601,273 K4804M probably damaging Het
Ice2 T C 9: 69,400,512 F26S probably damaging Het
Ints11 T C 4: 155,872,230 probably null Het
Ipo5 A G 14: 120,920,085 I112V probably benign Het
Itgax T A 7: 128,135,309 S346R probably damaging Het
Kcnj13 T A 1: 87,389,017 M125L probably damaging Het
Lmbrd1 T A 1: 24,744,867 V359E possibly damaging Het
Mau2 C T 8: 70,029,234 A191T possibly damaging Het
Mkx C A 18: 7,000,747 R65L possibly damaging Het
Mroh4 T A 15: 74,610,371 K746* probably null Het
Myh4 A G 11: 67,242,848 T238A probably damaging Het
Nlrp9c T A 7: 26,371,397 N920Y possibly damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Ntn4 T C 10: 93,644,804 L130P probably damaging Het
Olfr1240 A G 2: 89,440,198 V27A probably benign Het
Olfr1312 A T 2: 112,043,014 V6E possibly damaging Het
Olfr682-ps1 T A 7: 105,128,345 I21F probably benign Het
Olfr695 A G 7: 106,713,964 V239A probably benign Het
Olfr930 A T 9: 38,930,776 I202F probably damaging Het
Otog T C 7: 46,298,308 L110P probably damaging Het
Platr25 G A 13: 62,700,905 H48Y probably benign Het
Plcxd2 T C 16: 45,980,426 E145G probably damaging Het
Pltp A T 2: 164,854,322 N143K probably damaging Het
Pnpt1 T C 11: 29,161,334 Y735H probably damaging Het
Prom1 A G 5: 44,020,831 Y520H probably damaging Het
Rag2 A G 2: 101,630,773 Y476C probably damaging Het
Rdh16f2 A G 10: 127,877,024 Y297C probably damaging Het
Ryr1 T C 7: 29,085,755 E1844G probably benign Het
Ryr2 A G 13: 11,640,275 C3679R probably damaging Het
Sirt1 A G 10: 63,322,003 I544T probably benign Het
Slc26a10 A T 10: 127,176,847 I382N possibly damaging Het
Sox2 C A 3: 34,650,972 P186Q possibly damaging Het
Tnpo3 A G 6: 29,556,996 L752P probably damaging Het
Top2b T A 14: 16,416,649 N1136K probably benign Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Ttf2 C A 3: 100,963,302 D152Y possibly damaging Het
Txndc15 T C 13: 55,714,788 L4P unknown Het
Unc5a T C 13: 54,996,573 V237A possibly damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vav3 C A 3: 109,628,099 P616T possibly damaging Het
Vmn2r15 T A 5: 109,293,239 D251V probably benign Het
Vmn2r15 A G 5: 109,297,522 L12S probably benign Het
Wfs1 A C 5: 36,967,732 I605S probably benign Het
Wif1 G A 10: 121,083,909 R187Q possibly damaging Het
Yipf1 A G 4: 107,350,541 probably null Het
Zdhhc20 G T 14: 57,873,920 F74L possibly damaging Het
Zfp507 T C 7: 35,776,418 T303A unknown Het
Zfp763 A T 17: 33,033,378 probably benign Het
Other mutations in Lrrc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Lrrc7 APN 3 158187010 missense probably benign 0.07
IGL00644:Lrrc7 APN 3 158202368 nonsense probably null
IGL00822:Lrrc7 APN 3 158185474 missense probably damaging 0.99
IGL00927:Lrrc7 APN 3 158161090 missense possibly damaging 0.94
IGL00946:Lrrc7 APN 3 158161356 missense probably benign 0.07
IGL00948:Lrrc7 APN 3 158161557 missense probably damaging 1.00
IGL01838:Lrrc7 APN 3 158185463 missense probably damaging 1.00
IGL01874:Lrrc7 APN 3 158240443 splice site probably benign
IGL02514:Lrrc7 APN 3 158160292 missense probably damaging 0.96
IGL02545:Lrrc7 APN 3 158185374 splice site probably benign
IGL02665:Lrrc7 APN 3 158161105 missense probably damaging 0.99
IGL03129:Lrrc7 APN 3 158161059 missense probably benign 0.02
N/A:Lrrc7 UTSW 3 158160340 missense probably benign
R0021:Lrrc7 UTSW 3 158160661 missense probably damaging 1.00
R0041:Lrrc7 UTSW 3 158164260 splice site probably benign
R0255:Lrrc7 UTSW 3 158160838 nonsense probably null
R0278:Lrrc7 UTSW 3 158179795 missense possibly damaging 0.96
R0409:Lrrc7 UTSW 3 158161426 missense possibly damaging 0.59
R0612:Lrrc7 UTSW 3 158164353 missense probably damaging 0.98
R0866:Lrrc7 UTSW 3 158164266 splice site probably benign
R1077:Lrrc7 UTSW 3 158161143 missense probably damaging 1.00
R1103:Lrrc7 UTSW 3 158148706 splice site probably benign
R1157:Lrrc7 UTSW 3 158160255 missense probably damaging 1.00
R1187:Lrrc7 UTSW 3 158160402 missense probably damaging 1.00
R1301:Lrrc7 UTSW 3 158135331 missense probably benign 0.20
R1433:Lrrc7 UTSW 3 158177306 missense probably damaging 1.00
R1450:Lrrc7 UTSW 3 158187044 missense possibly damaging 0.62
R1595:Lrrc7 UTSW 3 158177277 nonsense probably null
R1659:Lrrc7 UTSW 3 158161408 missense probably damaging 1.00
R1693:Lrrc7 UTSW 3 158084533 missense possibly damaging 0.95
R1774:Lrrc7 UTSW 3 158160292 missense possibly damaging 0.88
R2273:Lrrc7 UTSW 3 158187059 missense probably damaging 1.00
R2276:Lrrc7 UTSW 3 158179792 missense probably damaging 1.00
R2302:Lrrc7 UTSW 3 158135244 missense probably damaging 0.99
R2326:Lrrc7 UTSW 3 158170661 missense probably damaging 1.00
R2371:Lrrc7 UTSW 3 158161060 missense probably damaging 0.99
R2383:Lrrc7 UTSW 3 158163956 missense probably benign
R2679:Lrrc7 UTSW 3 158175108 nonsense probably null
R2698:Lrrc7 UTSW 3 158135391 missense probably benign 0.22
R2858:Lrrc7 UTSW 3 158161725 missense probably damaging 0.99
R3758:Lrrc7 UTSW 3 158163965 missense probably damaging 1.00
R3791:Lrrc7 UTSW 3 158163956 missense probably benign
R3805:Lrrc7 UTSW 3 158185493 missense probably benign 0.10
R3806:Lrrc7 UTSW 3 158185493 missense probably benign 0.10
R3807:Lrrc7 UTSW 3 158185493 missense probably benign 0.10
R3892:Lrrc7 UTSW 3 158160696 missense probably benign 0.08
R3912:Lrrc7 UTSW 3 158291952 missense probably damaging 1.00
R3913:Lrrc7 UTSW 3 158291952 missense probably damaging 1.00
R3963:Lrrc7 UTSW 3 158160405 missense probably damaging 1.00
R4665:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4666:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4671:Lrrc7 UTSW 3 158202495 critical splice acceptor site probably null
R4688:Lrrc7 UTSW 3 158148605 missense probably damaging 1.00
R4725:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4726:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4728:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4783:Lrrc7 UTSW 3 158127213 critical splice donor site probably null
R4867:Lrrc7 UTSW 3 158161005 missense probably damaging 1.00
R4907:Lrrc7 UTSW 3 158161240 missense probably damaging 1.00
R5032:Lrrc7 UTSW 3 158181580 missense possibly damaging 0.85
R5107:Lrrc7 UTSW 3 158161896 missense probably damaging 1.00
R5295:Lrrc7 UTSW 3 158170739 missense probably damaging 1.00
R5348:Lrrc7 UTSW 3 158175326 missense probably benign 0.02
R5468:Lrrc7 UTSW 3 158318436 missense probably damaging 1.00
R5778:Lrrc7 UTSW 3 158170743 missense probably damaging 1.00
R5897:Lrrc7 UTSW 3 158164353 missense probably damaging 0.98
R6179:Lrrc7 UTSW 3 158353432 missense probably damaging 0.99
R6312:Lrrc7 UTSW 3 158160609 missense probably benign 0.04
R6313:Lrrc7 UTSW 3 158160736 missense probably damaging 1.00
R6366:Lrrc7 UTSW 3 158135375 missense probably benign 0.04
R6389:Lrrc7 UTSW 3 158185426 missense probably damaging 1.00
R6638:Lrrc7 UTSW 3 158135303 missense probably benign 0.20
R6956:Lrrc7 UTSW 3 158289031 missense probably benign 0.02
R6969:Lrrc7 UTSW 3 158156913 missense probably benign 0.19
R7073:Lrrc7 UTSW 3 158127247 missense probably damaging 1.00
R7313:Lrrc7 UTSW 3 158160474 missense probably damaging 1.00
R7398:Lrrc7 UTSW 3 158291958 nonsense probably null
R7403:Lrrc7 UTSW 3 158148674 nonsense probably null
R7407:Lrrc7 UTSW 3 158135241 missense probably damaging 1.00
R7427:Lrrc7 UTSW 3 158198141 missense probably benign 0.06
R7453:Lrrc7 UTSW 3 158185409 missense probably benign 0.00
R7461:Lrrc7 UTSW 3 158187020 missense probably benign 0.00
R7807:Lrrc7 UTSW 3 158160487 missense probably damaging 1.00
R7872:Lrrc7 UTSW 3 158353462 missense probably damaging 0.99
R8215:Lrrc7 UTSW 3 158209750 missense probably benign
R8367:Lrrc7 UTSW 3 158202370 missense possibly damaging 0.80
R8867:Lrrc7 UTSW 3 158161884 missense probably damaging 0.99
R8880:Lrrc7 UTSW 3 158161744 missense probably damaging 0.99
R8941:Lrrc7 UTSW 3 158163956 missense probably benign
R8958:Lrrc7 UTSW 3 158240501 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGCTTGAGAAAGGTTCATGACTG -3'
(R):5'- CCAAAGCTAGTCTGTGTTCTATTTG -3'

Sequencing Primer
(F):5'- GCTGATTCAGTGGTCAGATATAAAG -3'
(R):5'- GTGTGTTGTAATATGAAGAACATGGC -3'
Posted On2019-09-13