Incidental Mutation 'R7365:Lrrc7'
ID 571691
Institutional Source Beutler Lab
Gene Symbol Lrrc7
Ensembl Gene ENSMUSG00000028176
Gene Name leucine rich repeat containing 7
Synonyms densin
MMRRC Submission 045449-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.748) question?
Stock # R7365 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 157788528-158267858 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 157903798 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 287 (K287N)
Ref Sequence ENSEMBL: ENSMUSP00000142498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106044] [ENSMUST00000199890] [ENSMUST00000200137]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000106044
AA Change: K287N

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101659
Gene: ENSMUSG00000028176
AA Change: K287N

DomainStartEndE-ValueType
LRR 53 73 3.65e0 SMART
LRR 96 118 2.2e1 SMART
LRR 142 164 4.21e1 SMART
LRR 165 187 7.36e0 SMART
LRR 188 210 7.05e-1 SMART
LRR 211 233 3.09e1 SMART
LRR 234 257 4.21e1 SMART
LRR 258 279 2.61e2 SMART
LRR 280 303 3.52e-1 SMART
LRR 326 349 1.99e0 SMART
LRR 372 394 2.63e0 SMART
low complexity region 466 476 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
Blast:PDZ 708 736 1e-5 BLAST
low complexity region 787 797 N/A INTRINSIC
low complexity region 864 878 N/A INTRINSIC
Blast:PDZ 1349 1378 2e-11 BLAST
PDZ 1460 1540 1.33e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199890
AA Change: K287N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142440
Gene: ENSMUSG00000028176
AA Change: K287N

DomainStartEndE-ValueType
LRR 53 73 3.65e0 SMART
LRR 96 118 2.2e1 SMART
LRR 142 164 4.21e1 SMART
LRR 165 187 7.36e0 SMART
LRR 188 210 7.05e-1 SMART
LRR 211 233 3.09e1 SMART
LRR 234 257 4.21e1 SMART
LRR 258 279 2.61e2 SMART
LRR 280 303 3.52e-1 SMART
LRR 326 349 1.99e0 SMART
LRR 372 394 2.63e0 SMART
low complexity region 466 476 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
Blast:PDZ 708 736 9e-6 BLAST
low complexity region 787 797 N/A INTRINSIC
low complexity region 864 878 N/A INTRINSIC
Blast:PDZ 1328 1364 1e-15 BLAST
low complexity region 1374 1387 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200137
AA Change: K287N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142498
Gene: ENSMUSG00000028176
AA Change: K287N

DomainStartEndE-ValueType
LRR 52 69 7.6e-1 SMART
LRR 73 92 4.2e-1 SMART
LRR 96 115 3.4e-1 SMART
LRR 142 164 1.8e-1 SMART
LRR 165 184 1.5e-1 SMART
LRR 188 207 2e-2 SMART
LRR 211 233 1.3e-1 SMART
LRR 234 257 1.7e-1 SMART
LRR 257 276 1e0 SMART
LRR 280 299 3.1e-2 SMART
LRR 303 322 6.6e-1 SMART
LRR 326 345 2.1e-1 SMART
LRR 372 391 1.2e-1 SMART
low complexity region 466 476 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
Blast:PDZ 708 736 1e-5 BLAST
low complexity region 787 797 N/A INTRINSIC
low complexity region 864 878 N/A INTRINSIC
Blast:PDZ 1302 1331 2e-11 BLAST
PDZ 1413 1493 6.4e-22 SMART
Predicted Effect
Meta Mutation Damage Score 0.4184 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (96/96)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit limb grasping, reduced long term depression, increased anxiety, increased aggression towards other mice, impaired spatial memory, decreased prepulse inhibition, decreased nesting building behavior, and abnormal dendritic spines. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,561,198 (GRCm39) S155G probably benign Het
Abcc4 T C 14: 118,865,066 (GRCm39) N320S probably damaging Het
Akr1c19 G A 13: 4,287,069 (GRCm39) R96H probably benign Het
Ankrd17 T C 5: 90,439,010 (GRCm39) D451G possibly damaging Het
Ano8 T A 8: 71,937,754 (GRCm39) D36V probably damaging Het
Aqp3 A G 4: 41,098,003 (GRCm39) V36A probably benign Het
Atf7ip A G 6: 136,537,708 (GRCm39) T314A probably benign Het
Atp2c1 A T 9: 105,300,198 (GRCm39) D700E probably damaging Het
Axin2 G A 11: 108,830,202 (GRCm39) V341M possibly damaging Het
Bin3 A G 14: 70,371,976 (GRCm39) Q139R probably damaging Het
Brca2 A G 5: 150,455,802 (GRCm39) D181G probably damaging Het
Capn3 A G 2: 120,325,295 (GRCm39) E466G probably damaging Het
Ccdc14 T A 16: 34,543,989 (GRCm39) Y830* probably null Het
Cdk12 T C 11: 98,111,910 (GRCm39) F723L unknown Het
Cep89 G A 7: 35,129,353 (GRCm39) R630H probably damaging Het
Cip2a T A 16: 48,822,016 (GRCm39) S215T probably benign Het
Clca3a2 T A 3: 144,804,545 (GRCm39) I61F probably damaging Het
Clca4b T C 3: 144,628,529 (GRCm39) T393A not run Het
Cldn5 G A 16: 18,595,845 (GRCm39) A34T probably damaging Het
Cobll1 A T 2: 64,928,717 (GRCm39) S870T probably damaging Het
Col12a1 T C 9: 79,613,642 (GRCm39) K68E probably damaging Het
Crnn A T 3: 93,055,841 (GRCm39) Q209L probably damaging Het
Cwf19l1 A T 19: 44,120,579 (GRCm39) F45I probably damaging Het
Cyfip2 T A 11: 46,098,267 (GRCm39) K1052* probably null Het
D930020B18Rik G A 10: 121,503,716 (GRCm39) probably null Het
Dcc G A 18: 71,959,194 (GRCm39) P193S probably damaging Het
Dda1 T A 8: 71,927,137 (GRCm39) C48S probably benign Het
Disc1 A G 8: 125,881,780 (GRCm39) R572G probably damaging Het
Dnah7a A T 1: 53,536,297 (GRCm39) M2582K probably benign Het
Dsel C T 1: 111,789,303 (GRCm39) G411S probably damaging Het
Dynlrb2 T C 8: 117,241,696 (GRCm39) V80A probably benign Het
Eif3a A T 19: 60,755,082 (GRCm39) D1033E unknown Het
Enam C A 5: 88,649,347 (GRCm39) H285Q possibly damaging Het
Ep400 T C 5: 110,867,480 (GRCm39) D980G unknown Het
Epha7 C T 4: 28,871,937 (GRCm39) S422L probably benign Het
Erc2 A C 14: 27,762,346 (GRCm39) D703A probably damaging Het
Ezh2 G T 6: 47,510,692 (GRCm39) S639* probably null Het
Fbn1 G A 2: 125,193,969 (GRCm39) H1333Y probably damaging Het
Flad1 A G 3: 89,315,972 (GRCm39) S197P possibly damaging Het
Foxl3 A G 5: 138,806,736 (GRCm39) H82R probably damaging Het
Gfm2 G T 13: 97,279,529 (GRCm39) C26F probably benign Het
Golga2 C T 2: 32,193,013 (GRCm39) Q444* probably null Het
Gp5 A T 16: 30,127,426 (GRCm39) V416D probably damaging Het
Gpat2 A G 2: 127,268,901 (GRCm39) probably null Het
Gpr137c A G 14: 45,516,471 (GRCm39) D353G probably damaging Het
Hoxa13 A C 6: 52,236,862 (GRCm39) W133G probably damaging Het
Hydin A T 8: 111,327,905 (GRCm39) K4804M probably damaging Het
Hydin A T 8: 111,284,294 (GRCm39) I3189F probably damaging Het
Ice2 T C 9: 69,307,794 (GRCm39) F26S probably damaging Het
Ints11 T C 4: 155,956,687 (GRCm39) probably null Het
Ipo5 A G 14: 121,157,497 (GRCm39) I112V probably benign Het
Itgax T A 7: 127,734,481 (GRCm39) S346R probably damaging Het
Kcnj13 T A 1: 87,316,739 (GRCm39) M125L probably damaging Het
Lmbrd1 T A 1: 24,783,948 (GRCm39) V359E possibly damaging Het
Mau2 C T 8: 70,481,884 (GRCm39) A191T possibly damaging Het
Mkx C A 18: 7,000,747 (GRCm39) R65L possibly damaging Het
Mroh4 T A 15: 74,482,220 (GRCm39) K746* probably null Het
Myh4 A G 11: 67,133,674 (GRCm39) T238A probably damaging Het
Nlrp9c T A 7: 26,070,822 (GRCm39) N920Y possibly damaging Het
Nr4a3 T G 4: 48,051,290 (GRCm39) S15A possibly damaging Het
Ntn4 T C 10: 93,480,666 (GRCm39) L130P probably damaging Het
Or2ag13 A G 7: 106,313,171 (GRCm39) V239A probably benign Het
Or4a68 A G 2: 89,270,542 (GRCm39) V27A probably benign Het
Or4f59 A T 2: 111,873,359 (GRCm39) V6E possibly damaging Het
Or56a42-ps1 T A 7: 104,777,552 (GRCm39) I21F probably benign Het
Or8d23 A T 9: 38,842,072 (GRCm39) I202F probably damaging Het
Otog T C 7: 45,947,732 (GRCm39) L110P probably damaging Het
Platr25 G A 13: 62,848,719 (GRCm39) H48Y probably benign Het
Plcxd2 T C 16: 45,800,789 (GRCm39) E145G probably damaging Het
Pltp A T 2: 164,696,242 (GRCm39) N143K probably damaging Het
Pnpt1 T C 11: 29,111,334 (GRCm39) Y735H probably damaging Het
Prom1 A G 5: 44,178,173 (GRCm39) Y520H probably damaging Het
Rag2 A G 2: 101,461,118 (GRCm39) Y476C probably damaging Het
Rdh16f2 A G 10: 127,712,893 (GRCm39) Y297C probably damaging Het
Ryr1 T C 7: 28,785,180 (GRCm39) E1844G probably benign Het
Ryr2 A G 13: 11,655,161 (GRCm39) C3679R probably damaging Het
Sirt1 A G 10: 63,157,782 (GRCm39) I544T probably benign Het
Slc26a10 A T 10: 127,012,716 (GRCm39) I382N possibly damaging Het
Sox2 C A 3: 34,705,121 (GRCm39) P186Q possibly damaging Het
Spata31e5 A T 1: 28,819,233 (GRCm39) M16K probably benign Het
Tnpo3 A G 6: 29,556,995 (GRCm39) L752P probably damaging Het
Top2b T A 14: 16,416,649 (GRCm38) N1136K probably benign Het
Tpsg1 G T 17: 25,592,184 (GRCm39) G86V probably damaging Het
Ttf2 C A 3: 100,870,618 (GRCm39) D152Y possibly damaging Het
Txndc15 T C 13: 55,862,601 (GRCm39) L4P unknown Het
Unc5a T C 13: 55,144,386 (GRCm39) V237A possibly damaging Het
Urb1 CACTTAC CAC 16: 90,569,461 (GRCm39) probably benign Het
Vav3 C A 3: 109,535,415 (GRCm39) P616T possibly damaging Het
Vmn2r15 T A 5: 109,441,105 (GRCm39) D251V probably benign Het
Vmn2r15 A G 5: 109,445,388 (GRCm39) L12S probably benign Het
Wfs1 A C 5: 37,125,076 (GRCm39) I605S probably benign Het
Wif1 G A 10: 120,919,814 (GRCm39) R187Q possibly damaging Het
Yipf1 A G 4: 107,207,738 (GRCm39) probably null Het
Zdhhc20 G T 14: 58,111,377 (GRCm39) F74L possibly damaging Het
Zfp507 T C 7: 35,475,843 (GRCm39) T303A unknown Het
Zfp763 A T 17: 33,252,352 (GRCm39) probably benign Het
Other mutations in Lrrc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Lrrc7 APN 3 157,892,647 (GRCm39) missense probably benign 0.07
IGL00644:Lrrc7 APN 3 157,908,005 (GRCm39) nonsense probably null
IGL00822:Lrrc7 APN 3 157,891,111 (GRCm39) missense probably damaging 0.99
IGL00927:Lrrc7 APN 3 157,866,727 (GRCm39) missense possibly damaging 0.94
IGL00946:Lrrc7 APN 3 157,866,993 (GRCm39) missense probably benign 0.07
IGL00948:Lrrc7 APN 3 157,867,194 (GRCm39) missense probably damaging 1.00
IGL01838:Lrrc7 APN 3 157,891,100 (GRCm39) missense probably damaging 1.00
IGL01874:Lrrc7 APN 3 157,946,080 (GRCm39) splice site probably benign
IGL02514:Lrrc7 APN 3 157,865,929 (GRCm39) missense probably damaging 0.96
IGL02545:Lrrc7 APN 3 157,891,011 (GRCm39) splice site probably benign
IGL02665:Lrrc7 APN 3 157,866,742 (GRCm39) missense probably damaging 0.99
IGL03129:Lrrc7 APN 3 157,866,696 (GRCm39) missense probably benign 0.02
N/A:Lrrc7 UTSW 3 157,865,977 (GRCm39) missense probably benign
R0021:Lrrc7 UTSW 3 157,866,298 (GRCm39) missense probably damaging 1.00
R0041:Lrrc7 UTSW 3 157,869,897 (GRCm39) splice site probably benign
R0255:Lrrc7 UTSW 3 157,866,475 (GRCm39) nonsense probably null
R0278:Lrrc7 UTSW 3 157,885,432 (GRCm39) missense possibly damaging 0.96
R0409:Lrrc7 UTSW 3 157,867,063 (GRCm39) missense possibly damaging 0.59
R0612:Lrrc7 UTSW 3 157,869,990 (GRCm39) missense probably damaging 0.98
R0866:Lrrc7 UTSW 3 157,869,903 (GRCm39) splice site probably benign
R1077:Lrrc7 UTSW 3 157,866,780 (GRCm39) missense probably damaging 1.00
R1103:Lrrc7 UTSW 3 157,854,343 (GRCm39) splice site probably benign
R1157:Lrrc7 UTSW 3 157,865,892 (GRCm39) missense probably damaging 1.00
R1187:Lrrc7 UTSW 3 157,866,039 (GRCm39) missense probably damaging 1.00
R1301:Lrrc7 UTSW 3 157,840,968 (GRCm39) missense probably benign 0.20
R1433:Lrrc7 UTSW 3 157,882,943 (GRCm39) missense probably damaging 1.00
R1450:Lrrc7 UTSW 3 157,892,681 (GRCm39) missense possibly damaging 0.62
R1595:Lrrc7 UTSW 3 157,882,914 (GRCm39) nonsense probably null
R1659:Lrrc7 UTSW 3 157,867,045 (GRCm39) missense probably damaging 1.00
R1693:Lrrc7 UTSW 3 157,790,170 (GRCm39) missense possibly damaging 0.95
R1774:Lrrc7 UTSW 3 157,865,929 (GRCm39) missense possibly damaging 0.88
R2273:Lrrc7 UTSW 3 157,892,696 (GRCm39) missense probably damaging 1.00
R2276:Lrrc7 UTSW 3 157,885,429 (GRCm39) missense probably damaging 1.00
R2302:Lrrc7 UTSW 3 157,840,881 (GRCm39) missense probably damaging 0.99
R2326:Lrrc7 UTSW 3 157,876,298 (GRCm39) missense probably damaging 1.00
R2371:Lrrc7 UTSW 3 157,866,697 (GRCm39) missense probably damaging 0.99
R2383:Lrrc7 UTSW 3 157,869,593 (GRCm39) missense probably benign
R2679:Lrrc7 UTSW 3 157,880,745 (GRCm39) nonsense probably null
R2698:Lrrc7 UTSW 3 157,841,028 (GRCm39) missense probably benign 0.22
R2858:Lrrc7 UTSW 3 157,867,362 (GRCm39) missense probably damaging 0.99
R3758:Lrrc7 UTSW 3 157,869,602 (GRCm39) missense probably damaging 1.00
R3791:Lrrc7 UTSW 3 157,869,593 (GRCm39) missense probably benign
R3805:Lrrc7 UTSW 3 157,891,130 (GRCm39) missense probably benign 0.10
R3806:Lrrc7 UTSW 3 157,891,130 (GRCm39) missense probably benign 0.10
R3807:Lrrc7 UTSW 3 157,891,130 (GRCm39) missense probably benign 0.10
R3892:Lrrc7 UTSW 3 157,866,333 (GRCm39) missense probably benign 0.08
R3912:Lrrc7 UTSW 3 157,997,589 (GRCm39) missense probably damaging 1.00
R3913:Lrrc7 UTSW 3 157,997,589 (GRCm39) missense probably damaging 1.00
R3963:Lrrc7 UTSW 3 157,866,042 (GRCm39) missense probably damaging 1.00
R4665:Lrrc7 UTSW 3 158,024,045 (GRCm39) critical splice donor site probably benign
R4666:Lrrc7 UTSW 3 158,024,045 (GRCm39) critical splice donor site probably benign
R4671:Lrrc7 UTSW 3 157,908,132 (GRCm39) critical splice acceptor site probably null
R4688:Lrrc7 UTSW 3 157,854,242 (GRCm39) missense probably damaging 1.00
R4725:Lrrc7 UTSW 3 158,024,045 (GRCm39) critical splice donor site probably benign
R4726:Lrrc7 UTSW 3 158,024,045 (GRCm39) critical splice donor site probably benign
R4728:Lrrc7 UTSW 3 158,024,045 (GRCm39) critical splice donor site probably benign
R4783:Lrrc7 UTSW 3 157,832,850 (GRCm39) critical splice donor site probably null
R4867:Lrrc7 UTSW 3 157,866,642 (GRCm39) missense probably damaging 1.00
R4907:Lrrc7 UTSW 3 157,866,877 (GRCm39) missense probably damaging 1.00
R5032:Lrrc7 UTSW 3 157,887,217 (GRCm39) missense possibly damaging 0.85
R5107:Lrrc7 UTSW 3 157,867,533 (GRCm39) missense probably damaging 1.00
R5295:Lrrc7 UTSW 3 157,876,376 (GRCm39) missense probably damaging 1.00
R5348:Lrrc7 UTSW 3 157,880,963 (GRCm39) missense probably benign 0.02
R5468:Lrrc7 UTSW 3 158,024,073 (GRCm39) missense probably damaging 1.00
R5778:Lrrc7 UTSW 3 157,876,380 (GRCm39) missense probably damaging 1.00
R5897:Lrrc7 UTSW 3 157,869,990 (GRCm39) missense probably damaging 0.98
R6179:Lrrc7 UTSW 3 158,059,069 (GRCm39) missense probably damaging 0.99
R6312:Lrrc7 UTSW 3 157,866,246 (GRCm39) missense probably benign 0.04
R6313:Lrrc7 UTSW 3 157,866,373 (GRCm39) missense probably damaging 1.00
R6366:Lrrc7 UTSW 3 157,841,012 (GRCm39) missense probably benign 0.04
R6389:Lrrc7 UTSW 3 157,891,063 (GRCm39) missense probably damaging 1.00
R6638:Lrrc7 UTSW 3 157,840,940 (GRCm39) missense probably benign 0.20
R6956:Lrrc7 UTSW 3 157,994,668 (GRCm39) missense probably benign 0.02
R6969:Lrrc7 UTSW 3 157,862,550 (GRCm39) missense probably benign 0.19
R7073:Lrrc7 UTSW 3 157,832,884 (GRCm39) missense probably damaging 1.00
R7313:Lrrc7 UTSW 3 157,866,111 (GRCm39) missense probably damaging 1.00
R7398:Lrrc7 UTSW 3 157,997,595 (GRCm39) nonsense probably null
R7403:Lrrc7 UTSW 3 157,854,311 (GRCm39) nonsense probably null
R7407:Lrrc7 UTSW 3 157,840,878 (GRCm39) missense probably damaging 1.00
R7427:Lrrc7 UTSW 3 157,903,778 (GRCm39) missense probably benign 0.06
R7453:Lrrc7 UTSW 3 157,891,046 (GRCm39) missense probably benign 0.00
R7461:Lrrc7 UTSW 3 157,892,657 (GRCm39) missense probably benign 0.00
R7807:Lrrc7 UTSW 3 157,866,124 (GRCm39) missense probably damaging 1.00
R7872:Lrrc7 UTSW 3 158,059,099 (GRCm39) missense probably damaging 0.99
R8215:Lrrc7 UTSW 3 157,915,387 (GRCm39) missense probably benign
R8367:Lrrc7 UTSW 3 157,908,007 (GRCm39) missense possibly damaging 0.80
R8867:Lrrc7 UTSW 3 157,867,521 (GRCm39) missense probably damaging 0.99
R8880:Lrrc7 UTSW 3 157,867,381 (GRCm39) missense probably damaging 0.99
R8941:Lrrc7 UTSW 3 157,869,593 (GRCm39) missense probably benign
R8958:Lrrc7 UTSW 3 157,946,138 (GRCm39) missense probably benign 0.02
R9068:Lrrc7 UTSW 3 157,946,138 (GRCm39) missense probably benign 0.02
R9069:Lrrc7 UTSW 3 157,946,138 (GRCm39) missense probably benign 0.02
R9180:Lrrc7 UTSW 3 157,867,011 (GRCm39) missense possibly damaging 0.61
R9193:Lrrc7 UTSW 3 158,059,011 (GRCm39) nonsense probably null
R9309:Lrrc7 UTSW 3 157,915,361 (GRCm39) nonsense probably null
R9418:Lrrc7 UTSW 3 157,908,023 (GRCm39) missense possibly damaging 0.66
R9474:Lrrc7 UTSW 3 157,841,028 (GRCm39) missense probably benign 0.22
R9515:Lrrc7 UTSW 3 157,867,105 (GRCm39) missense probably damaging 1.00
R9635:Lrrc7 UTSW 3 157,946,138 (GRCm39) missense probably benign 0.02
R9639:Lrrc7 UTSW 3 157,946,138 (GRCm39) missense probably benign 0.02
R9682:Lrrc7 UTSW 3 157,882,954 (GRCm39) missense possibly damaging 0.92
R9731:Lrrc7 UTSW 3 157,880,888 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTTGAGAAAGGTTCATGACTG -3'
(R):5'- CCAAAGCTAGTCTGTGTTCTATTTG -3'

Sequencing Primer
(F):5'- GCTGATTCAGTGGTCAGATATAAAG -3'
(R):5'- GTGTGTTGTAATATGAAGAACATGGC -3'
Posted On 2019-09-13