Incidental Mutation 'R7365:Col12a1'
ID571725
Institutional Source Beutler Lab
Gene Symbol Col12a1
Ensembl Gene ENSMUSG00000032332
Gene Namecollagen, type XII, alpha 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.739) question?
Stock #R7365 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location79598991-79718831 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79706360 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 68 (K68E)
Ref Sequence ENSEMBL: ENSMUSP00000071662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071750] [ENSMUST00000121227]
Predicted Effect probably damaging
Transcript: ENSMUST00000071750
AA Change: K68E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071662
Gene: ENSMUSG00000032332
AA Change: K68E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 25 103 2.29e-10 SMART
low complexity region 114 129 N/A INTRINSIC
VWA 138 317 4e-63 SMART
FN3 334 413 1.47e-8 SMART
VWA 438 617 2.41e-57 SMART
FN3 632 710 1.62e-10 SMART
FN3 723 801 2.91e-12 SMART
FN3 814 892 6.05e-10 SMART
FN3 905 984 2.74e-8 SMART
FN3 995 1074 1.24e-6 SMART
FN3 1087 1166 5.78e-7 SMART
VWA 1197 1376 2.02e-59 SMART
FN3 1385 1463 1.13e-9 SMART
FN3 1474 1554 1.07e-10 SMART
FN3 1566 1643 3.73e-10 SMART
FN3 1655 1734 2.94e-8 SMART
FN3 1755 1834 1.54e-11 SMART
FN3 1846 1924 1.45e-7 SMART
FN3 1936 2015 1.47e-8 SMART
FN3 2027 2106 1.21e-9 SMART
FN3 2118 2195 2.14e-10 SMART
FN3 2206 2285 3.85e-3 SMART
low complexity region 2292 2314 N/A INTRINSIC
VWA 2323 2503 2.61e-53 SMART
TSPN 2522 2714 1.13e-76 SMART
Pfam:Collagen 2747 2804 1.7e-8 PFAM
Pfam:Collagen 2802 2855 6.5e-9 PFAM
Pfam:Collagen 2844 2904 1.1e-9 PFAM
Pfam:Collagen 2939 2994 4.6e-8 PFAM
low complexity region 3011 3044 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121227
AA Change: K68E

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112604
Gene: ENSMUSG00000032332
AA Change: K68E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 25 103 2.29e-10 SMART
low complexity region 114 129 N/A INTRINSIC
VWA 138 317 4e-63 SMART
FN3 334 413 1.47e-8 SMART
VWA 438 617 2.41e-57 SMART
FN3 632 710 1.62e-10 SMART
FN3 723 801 2.91e-12 SMART
FN3 814 892 6.05e-10 SMART
FN3 905 984 2.74e-8 SMART
FN3 995 1074 1.24e-6 SMART
FN3 1087 1166 5.78e-7 SMART
VWA 1197 1376 2.02e-59 SMART
FN3 1385 1463 1.13e-9 SMART
FN3 1474 1554 1.07e-10 SMART
FN3 1566 1643 3.73e-10 SMART
FN3 1655 1734 2.94e-8 SMART
FN3 1755 1834 1.54e-11 SMART
FN3 1846 1924 1.45e-7 SMART
FN3 1936 2015 1.47e-8 SMART
FN3 2027 2106 1.21e-9 SMART
FN3 2118 2195 2.14e-10 SMART
FN3 2206 2285 3.85e-3 SMART
low complexity region 2292 2314 N/A INTRINSIC
VWA 2323 2503 2.61e-53 SMART
TSPN 2522 2714 1.13e-76 SMART
Pfam:Collagen 2747 2804 4.7e-9 PFAM
Pfam:Collagen 2802 2861 2.9e-9 PFAM
Pfam:Collagen 2838 2900 7.1e-8 PFAM
Pfam:Collagen 2935 2990 1.3e-8 PFAM
low complexity region 3007 3040 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XII collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XII collagen is a homotrimer found in association with type I collagen, an association that is thought to modify the interactions between collagen I fibrils and the surrounding matrix. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial perinatal lethality, decreased body weight, shorter and slender long bones, altered vertebrae structure, kyphosis, decreased bone strength, and abnormalities in osteoblast differentiation and bone matrix formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,562,936 S155G probably benign Het
Abcc4 T C 14: 118,627,654 N320S probably damaging Het
Akr1c19 G A 13: 4,237,070 R96H probably benign Het
Ankrd17 T C 5: 90,291,151 D451G possibly damaging Het
Ano8 T A 8: 71,485,110 D36V probably damaging Het
Aqp3 A G 4: 41,098,003 V36A probably benign Het
Atf7ip A G 6: 136,560,710 T314A probably benign Het
Atp2c1 A T 9: 105,422,999 D700E probably damaging Het
Axin2 G A 11: 108,939,376 V341M possibly damaging Het
Bin3 A G 14: 70,134,527 Q139R probably damaging Het
Brca2 A G 5: 150,532,337 D181G probably damaging Het
C330027C09Rik T A 16: 49,001,653 S215T probably benign Het
Capn3 A G 2: 120,494,814 E466G probably damaging Het
Ccdc14 T A 16: 34,723,619 Y830* probably null Het
Cdk12 T C 11: 98,221,084 F723L unknown Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Clca2 T A 3: 145,098,784 I61F probably damaging Het
Clca4b T C 3: 144,922,768 T393A not run Het
Cldn5 G A 16: 18,777,095 A34T probably damaging Het
Cobll1 A T 2: 65,098,373 S870T probably damaging Het
Crnn A T 3: 93,148,534 Q209L probably damaging Het
Cwf19l1 A T 19: 44,132,140 F45I probably damaging Het
Cyfip2 T A 11: 46,207,440 K1052* probably null Het
D930020B18Rik G A 10: 121,667,811 probably null Het
Dcc G A 18: 71,826,123 P193S probably damaging Het
Dda1 T A 8: 71,474,493 C48S probably benign Het
Disc1 A G 8: 125,155,041 R572G probably damaging Het
Dnah7a A T 1: 53,497,138 M2582K probably benign Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Dynlrb2 T C 8: 116,514,957 V80A probably benign Het
Eif3a A T 19: 60,766,644 D1033E unknown Het
Enam C A 5: 88,501,488 H285Q possibly damaging Het
Ep400 T C 5: 110,719,614 D980G unknown Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Erc2 A C 14: 28,040,389 D703A probably damaging Het
Ezh2 G T 6: 47,533,758 S639* probably null Het
Fbn1 G A 2: 125,352,049 H1333Y probably damaging Het
Flad1 A G 3: 89,408,665 S197P possibly damaging Het
Gfm2 G T 13: 97,143,021 C26F probably benign Het
Gm5294 A G 5: 138,820,981 H82R probably damaging Het
Gm597 A T 1: 28,780,152 M16K probably benign Het
Golga2 C T 2: 32,303,001 Q444* probably null Het
Gp5 A T 16: 30,308,608 V416D probably damaging Het
Gpat2 A G 2: 127,426,981 probably null Het
Gpr137c A G 14: 45,279,014 D353G probably damaging Het
Hoxa13 A C 6: 52,259,882 W133G probably damaging Het
Hydin A T 8: 110,557,662 I3189F probably damaging Het
Hydin A T 8: 110,601,273 K4804M probably damaging Het
Ice2 T C 9: 69,400,512 F26S probably damaging Het
Ints11 T C 4: 155,872,230 probably null Het
Ipo5 A G 14: 120,920,085 I112V probably benign Het
Itgax T A 7: 128,135,309 S346R probably damaging Het
Kcnj13 T A 1: 87,389,017 M125L probably damaging Het
Lmbrd1 T A 1: 24,744,867 V359E possibly damaging Het
Lrrc7 T G 3: 158,198,161 K287N probably damaging Het
Mau2 C T 8: 70,029,234 A191T possibly damaging Het
Mkx C A 18: 7,000,747 R65L possibly damaging Het
Mroh4 T A 15: 74,610,371 K746* probably null Het
Myh4 A G 11: 67,242,848 T238A probably damaging Het
Nlrp9c T A 7: 26,371,397 N920Y possibly damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Ntn4 T C 10: 93,644,804 L130P probably damaging Het
Olfr1240 A G 2: 89,440,198 V27A probably benign Het
Olfr1312 A T 2: 112,043,014 V6E possibly damaging Het
Olfr682-ps1 T A 7: 105,128,345 I21F probably benign Het
Olfr695 A G 7: 106,713,964 V239A probably benign Het
Olfr930 A T 9: 38,930,776 I202F probably damaging Het
Otog T C 7: 46,298,308 L110P probably damaging Het
Platr25 G A 13: 62,700,905 H48Y probably benign Het
Plcxd2 T C 16: 45,980,426 E145G probably damaging Het
Pltp A T 2: 164,854,322 N143K probably damaging Het
Pnpt1 T C 11: 29,161,334 Y735H probably damaging Het
Prom1 A G 5: 44,020,831 Y520H probably damaging Het
Rag2 A G 2: 101,630,773 Y476C probably damaging Het
Rdh16f2 A G 10: 127,877,024 Y297C probably damaging Het
Ryr1 T C 7: 29,085,755 E1844G probably benign Het
Ryr2 A G 13: 11,640,275 C3679R probably damaging Het
Sirt1 A G 10: 63,322,003 I544T probably benign Het
Slc26a10 A T 10: 127,176,847 I382N possibly damaging Het
Sox2 C A 3: 34,650,972 P186Q possibly damaging Het
Tnpo3 A G 6: 29,556,996 L752P probably damaging Het
Top2b T A 14: 16,416,649 N1136K probably benign Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Ttf2 C A 3: 100,963,302 D152Y possibly damaging Het
Txndc15 T C 13: 55,714,788 L4P unknown Het
Unc5a T C 13: 54,996,573 V237A possibly damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vav3 C A 3: 109,628,099 P616T possibly damaging Het
Vmn2r15 T A 5: 109,293,239 D251V probably benign Het
Vmn2r15 A G 5: 109,297,522 L12S probably benign Het
Wfs1 A C 5: 36,967,732 I605S probably benign Het
Wif1 G A 10: 121,083,909 R187Q possibly damaging Het
Yipf1 A G 4: 107,350,541 probably null Het
Zdhhc20 G T 14: 57,873,920 F74L possibly damaging Het
Zfp507 T C 7: 35,776,418 T303A unknown Het
Zfp763 A T 17: 33,033,378 probably benign Het
Other mutations in Col12a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Col12a1 APN 9 79681537 missense possibly damaging 0.55
IGL00434:Col12a1 APN 9 79653332 missense probably benign 0.27
IGL00465:Col12a1 APN 9 79697581 missense probably damaging 1.00
IGL00568:Col12a1 APN 9 79651477 missense probably damaging 1.00
IGL00576:Col12a1 APN 9 79647652 missense probably damaging 1.00
IGL00580:Col12a1 APN 9 79692226 missense probably benign 0.05
IGL01015:Col12a1 APN 9 79633741 missense probably damaging 1.00
IGL01124:Col12a1 APN 9 79703847 missense probably damaging 1.00
IGL01138:Col12a1 APN 9 79678053 missense probably damaging 1.00
IGL01295:Col12a1 APN 9 79643926 missense probably damaging 1.00
IGL01630:Col12a1 APN 9 79657366 missense probably damaging 1.00
IGL01648:Col12a1 APN 9 79601169 makesense probably null
IGL01878:Col12a1 APN 9 79649975 missense possibly damaging 0.72
IGL01921:Col12a1 APN 9 79650017 missense possibly damaging 0.50
IGL02064:Col12a1 APN 9 79692372 missense probably benign 0.06
IGL02123:Col12a1 APN 9 79662458 critical splice donor site probably null
IGL02312:Col12a1 APN 9 79681515 missense probably damaging 1.00
IGL02320:Col12a1 APN 9 79616021 critical splice donor site probably null
IGL02328:Col12a1 APN 9 79682066 missense probably damaging 1.00
IGL02342:Col12a1 APN 9 79649896 splice site probably null
IGL02355:Col12a1 APN 9 79630711 splice site probably benign
IGL02362:Col12a1 APN 9 79630711 splice site probably benign
IGL02396:Col12a1 APN 9 79662583 missense probably benign
IGL02449:Col12a1 APN 9 79641469 missense probably damaging 1.00
IGL02682:Col12a1 APN 9 79699341 missense probably damaging 1.00
IGL02751:Col12a1 APN 9 79613859 unclassified probably benign
IGL02801:Col12a1 APN 9 79608414 splice site probably null
IGL03001:Col12a1 APN 9 79633673 missense probably damaging 1.00
IGL03027:Col12a1 APN 9 79641551 missense probably benign 0.40
IGL03090:Col12a1 APN 9 79678370 missense probably damaging 1.00
IGL03115:Col12a1 APN 9 79681437 missense probably damaging 1.00
IGL03220:Col12a1 APN 9 79699483 missense probably damaging 1.00
IGL03240:Col12a1 APN 9 79678383 splice site probably null
IGL03348:Col12a1 APN 9 79693430 missense possibly damaging 0.88
Feast UTSW 9 79700262 missense probably benign 0.00
hardly UTSW 9 79700350 nonsense probably null
hearty UTSW 9 79643966 missense probably damaging 1.00
Hefty UTSW 9 79662454 splice site probably benign
P0045:Col12a1 UTSW 9 79647611 missense probably damaging 0.99
PIT4260001:Col12a1 UTSW 9 79651380 critical splice donor site probably null
PIT4280001:Col12a1 UTSW 9 79678105 missense probably damaging 1.00
R0015:Col12a1 UTSW 9 79651385 missense probably damaging 1.00
R0015:Col12a1 UTSW 9 79651385 missense probably damaging 1.00
R0240:Col12a1 UTSW 9 79652033 missense probably benign 0.02
R0276:Col12a1 UTSW 9 79630741 nonsense probably null
R0309:Col12a1 UTSW 9 79600011 unclassified probably null
R0336:Col12a1 UTSW 9 79702345 missense probably damaging 0.98
R0376:Col12a1 UTSW 9 79693494 missense probably benign 0.10
R0413:Col12a1 UTSW 9 79699360 missense probably damaging 0.99
R0504:Col12a1 UTSW 9 79681468 missense possibly damaging 0.90
R0542:Col12a1 UTSW 9 79605328 critical splice donor site probably null
R0610:Col12a1 UTSW 9 79707848 missense probably benign
R0631:Col12a1 UTSW 9 79703376 missense probably damaging 1.00
R0637:Col12a1 UTSW 9 79656735 missense probably benign 0.00
R0667:Col12a1 UTSW 9 79628462 missense probably damaging 1.00
R0711:Col12a1 UTSW 9 79652035 missense probably damaging 1.00
R0717:Col12a1 UTSW 9 79612419 missense probably damaging 1.00
R0762:Col12a1 UTSW 9 79681374 splice site probably benign
R0787:Col12a1 UTSW 9 79638485 missense probably damaging 0.99
R0890:Col12a1 UTSW 9 79700402 missense probably damaging 0.97
R0900:Col12a1 UTSW 9 79684253 missense possibly damaging 0.91
R1109:Col12a1 UTSW 9 79699723 missense probably damaging 1.00
R1264:Col12a1 UTSW 9 79620089 missense probably benign 0.09
R1321:Col12a1 UTSW 9 79617709 nonsense probably null
R1344:Col12a1 UTSW 9 79699555 nonsense probably null
R1387:Col12a1 UTSW 9 79681375 splice site probably benign
R1511:Col12a1 UTSW 9 79699552 missense probably benign 0.02
R1523:Col12a1 UTSW 9 79660996 missense probably benign 0.01
R1526:Col12a1 UTSW 9 79656798 missense probably benign 0.44
R1564:Col12a1 UTSW 9 79613840 missense probably damaging 1.00
R1595:Col12a1 UTSW 9 79602254 missense probably damaging 1.00
R1603:Col12a1 UTSW 9 79612962 missense probably damaging 1.00
R1673:Col12a1 UTSW 9 79693538 missense probably benign 0.00
R1730:Col12a1 UTSW 9 79628378 missense possibly damaging 0.93
R1737:Col12a1 UTSW 9 79703451 missense probably damaging 1.00
R1739:Col12a1 UTSW 9 79633468 missense probably damaging 0.98
R1748:Col12a1 UTSW 9 79672997 missense probably benign 0.01
R1778:Col12a1 UTSW 9 79604585 splice site probably benign
R1845:Col12a1 UTSW 9 79697541 missense probably benign 0.09
R1864:Col12a1 UTSW 9 79627103 splice site probably null
R1876:Col12a1 UTSW 9 79678281 nonsense probably null
R1934:Col12a1 UTSW 9 79604522 nonsense probably null
R1942:Col12a1 UTSW 9 79635466 missense probably damaging 1.00
R1950:Col12a1 UTSW 9 79630549 missense possibly damaging 0.62
R2027:Col12a1 UTSW 9 79645793 critical splice acceptor site probably null
R2061:Col12a1 UTSW 9 79617705 missense possibly damaging 0.88
R2064:Col12a1 UTSW 9 79662454 splice site probably benign
R2070:Col12a1 UTSW 9 79647696 missense probably benign 0.00
R2112:Col12a1 UTSW 9 79643899 missense possibly damaging 0.93
R2209:Col12a1 UTSW 9 79692352 missense possibly damaging 0.83
R2275:Col12a1 UTSW 9 79635427 missense probably damaging 0.99
R2330:Col12a1 UTSW 9 79633657 missense probably damaging 0.99
R2373:Col12a1 UTSW 9 79656813 missense probably benign 0.03
R2425:Col12a1 UTSW 9 79678366 missense probably damaging 1.00
R2428:Col12a1 UTSW 9 79602251 missense probably benign 0.30
R2437:Col12a1 UTSW 9 79692219 missense probably damaging 0.97
R2831:Col12a1 UTSW 9 79697401 missense probably null 0.99
R2851:Col12a1 UTSW 9 79678332 missense probably damaging 1.00
R2872:Col12a1 UTSW 9 79699549 missense probably damaging 1.00
R2872:Col12a1 UTSW 9 79699549 missense probably damaging 1.00
R2874:Col12a1 UTSW 9 79699549 missense probably damaging 1.00
R2904:Col12a1 UTSW 9 79652025 missense probably damaging 1.00
R2905:Col12a1 UTSW 9 79652025 missense probably damaging 1.00
R2991:Col12a1 UTSW 9 79700265 missense probably damaging 1.00
R3402:Col12a1 UTSW 9 79643947 missense probably damaging 1.00
R3429:Col12a1 UTSW 9 79680311 missense probably benign
R3430:Col12a1 UTSW 9 79680311 missense probably benign
R3547:Col12a1 UTSW 9 79633416 missense probably damaging 1.00
R3789:Col12a1 UTSW 9 79639723 missense possibly damaging 0.96
R4091:Col12a1 UTSW 9 79702364 missense probably damaging 0.99
R4328:Col12a1 UTSW 9 79700389 missense possibly damaging 0.91
R4382:Col12a1 UTSW 9 79630741 nonsense probably null
R4392:Col12a1 UTSW 9 79662488 missense probably damaging 1.00
R4405:Col12a1 UTSW 9 79639965 critical splice donor site probably null
R4465:Col12a1 UTSW 9 79672910 missense possibly damaging 0.62
R4521:Col12a1 UTSW 9 79633357 missense probably benign 0.00
R4612:Col12a1 UTSW 9 79616057 missense probably damaging 0.99
R4613:Col12a1 UTSW 9 79647601 missense probably benign 0.03
R4649:Col12a1 UTSW 9 79639794 missense probably damaging 1.00
R4651:Col12a1 UTSW 9 79612946 missense probably damaging 1.00
R4652:Col12a1 UTSW 9 79612946 missense probably damaging 1.00
R4738:Col12a1 UTSW 9 79699282 missense probably damaging 1.00
R4745:Col12a1 UTSW 9 79652086 splice site probably null
R4761:Col12a1 UTSW 9 79657310 missense probably benign 0.34
R4784:Col12a1 UTSW 9 79678494 missense possibly damaging 0.50
R4785:Col12a1 UTSW 9 79678494 missense possibly damaging 0.50
R4809:Col12a1 UTSW 9 79693567 missense probably benign 0.10
R4821:Col12a1 UTSW 9 79715340 intron probably benign
R4925:Col12a1 UTSW 9 79674795 missense probably damaging 1.00
R4938:Col12a1 UTSW 9 79700350 nonsense probably null
R5034:Col12a1 UTSW 9 79657367 missense probably damaging 1.00
R5133:Col12a1 UTSW 9 79605174 missense probably damaging 0.99
R5138:Col12a1 UTSW 9 79643966 missense probably damaging 1.00
R5145:Col12a1 UTSW 9 79706300 missense probably benign 0.00
R5152:Col12a1 UTSW 9 79656748 missense probably damaging 1.00
R5237:Col12a1 UTSW 9 79700262 missense probably benign 0.00
R5268:Col12a1 UTSW 9 79678047 missense probably damaging 0.99
R5328:Col12a1 UTSW 9 79620060 missense probably damaging 0.96
R5372:Col12a1 UTSW 9 79678366 missense probably damaging 1.00
R5440:Col12a1 UTSW 9 79614363 missense probably benign 0.07
R5496:Col12a1 UTSW 9 79602185 splice site probably benign
R5537:Col12a1 UTSW 9 79699590 missense probably damaging 1.00
R5596:Col12a1 UTSW 9 79703759 missense probably damaging 1.00
R5677:Col12a1 UTSW 9 79699321 missense probably damaging 1.00
R5715:Col12a1 UTSW 9 79616065 nonsense probably null
R5796:Col12a1 UTSW 9 79703829 missense possibly damaging 0.73
R5829:Col12a1 UTSW 9 79633673 missense probably damaging 1.00
R5865:Col12a1 UTSW 9 79604478 missense probably benign 0.00
R5919:Col12a1 UTSW 9 79602298 missense probably damaging 0.99
R5974:Col12a1 UTSW 9 79682127 missense probably damaging 0.99
R5981:Col12a1 UTSW 9 79678506 missense probably damaging 0.99
R5982:Col12a1 UTSW 9 79630560 missense probably damaging 1.00
R6027:Col12a1 UTSW 9 79656578 critical splice donor site probably null
R6090:Col12a1 UTSW 9 79692393 missense probably damaging 1.00
R6293:Col12a1 UTSW 9 79614358 missense probably benign 0.00
R6393:Col12a1 UTSW 9 79655485 missense probably damaging 0.99
R6457:Col12a1 UTSW 9 79645691 missense probably damaging 1.00
R6505:Col12a1 UTSW 9 79647605 missense probably damaging 0.98
R6508:Col12a1 UTSW 9 79649949 missense probably damaging 1.00
R6620:Col12a1 UTSW 9 79620049 missense probably damaging 0.98
R6718:Col12a1 UTSW 9 79699605 missense probably damaging 1.00
R6752:Col12a1 UTSW 9 79633424 missense possibly damaging 0.72
R6774:Col12a1 UTSW 9 79706337 missense possibly damaging 0.65
R6872:Col12a1 UTSW 9 79677234 missense probably damaging 1.00
R6884:Col12a1 UTSW 9 79639809 missense possibly damaging 0.92
R6935:Col12a1 UTSW 9 79700500 missense possibly damaging 0.76
R7198:Col12a1 UTSW 9 79650032 missense possibly damaging 0.56
R7296:Col12a1 UTSW 9 79682066 missense probably damaging 1.00
R7466:Col12a1 UTSW 9 79655407 missense possibly damaging 0.95
R7516:Col12a1 UTSW 9 79612910 splice site probably null
R7584:Col12a1 UTSW 9 79703296 critical splice donor site probably null
R7624:Col12a1 UTSW 9 79645794 splice site probably null
R7670:Col12a1 UTSW 9 79631643 missense probably damaging 1.00
R7678:Col12a1 UTSW 9 79651486 missense probably damaging 0.99
R7702:Col12a1 UTSW 9 79681521 missense probably damaging 1.00
R7796:Col12a1 UTSW 9 79678551 missense possibly damaging 0.88
R7902:Col12a1 UTSW 9 79641581 missense probably benign 0.00
R7923:Col12a1 UTSW 9 79678493 missense probably benign 0.00
R7986:Col12a1 UTSW 9 79604392 critical splice donor site probably null
R8004:Col12a1 UTSW 9 79684401 missense probably damaging 1.00
R8046:Col12a1 UTSW 9 79706226 critical splice donor site probably null
R8056:Col12a1 UTSW 9 79599938 missense
R8151:Col12a1 UTSW 9 79630549 missense possibly damaging 0.62
R8203:Col12a1 UTSW 9 79681549 missense possibly damaging 0.94
R8221:Col12a1 UTSW 9 79643942 missense probably damaging 1.00
R8294:Col12a1 UTSW 9 79699312 missense possibly damaging 0.91
R8309:Col12a1 UTSW 9 79605183 missense possibly damaging 0.68
R8319:Col12a1 UTSW 9 79648697 missense probably damaging 0.97
X0021:Col12a1 UTSW 9 79608485 missense probably damaging 1.00
X0058:Col12a1 UTSW 9 79602224 missense possibly damaging 0.66
X0061:Col12a1 UTSW 9 79612392 splice site probably null
Z1177:Col12a1 UTSW 9 79599986 missense possibly damaging 0.80
Z1177:Col12a1 UTSW 9 79639696 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCTGAAGCTGGAAAATTGTCTG -3'
(R):5'- TGAGTGTGATTGTCAGATAAAGGC -3'

Sequencing Primer
(F):5'- GCTGGAAAATTGTCTGCAAAATAC -3'
(R):5'- GTGTGATTGTCAGATAAAGGCAATAC -3'
Posted On2019-09-13