Incidental Mutation 'R7365:Slc26a10'
ID571730
Institutional Source Beutler Lab
Gene Symbol Slc26a10
Ensembl Gene ENSMUSG00000040441
Gene Namesolute carrier family 26, member 10
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7365 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location127171393-127180645 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127176847 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 382 (I382N)
Ref Sequence ENSEMBL: ENSMUSP00000092904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006914] [ENSMUST00000095270] [ENSMUST00000217678] [ENSMUST00000222911]
Predicted Effect probably benign
Transcript: ENSMUST00000006914
SMART Domains Protein: ENSMUSP00000006914
Gene: ENSMUSG00000006731

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
low complexity region 191 202 N/A INTRINSIC
Pfam:Glycos_transf_2 280 450 7e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000095270
AA Change: I382N

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000092904
Gene: ENSMUSG00000040441
AA Change: I382N

DomainStartEndE-ValueType
low complexity region 51 78 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
Pfam:Sulfate_transp 105 497 5.5e-103 PFAM
low complexity region 512 522 N/A INTRINSIC
Pfam:STAS 549 664 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217678
Predicted Effect possibly damaging
Transcript: ENSMUST00000222911
AA Change: I374N

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (96/96)
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,562,936 S155G probably benign Het
Abcc4 T C 14: 118,627,654 N320S probably damaging Het
Akr1c19 G A 13: 4,237,070 R96H probably benign Het
Ankrd17 T C 5: 90,291,151 D451G possibly damaging Het
Ano8 T A 8: 71,485,110 D36V probably damaging Het
Aqp3 A G 4: 41,098,003 V36A probably benign Het
Atf7ip A G 6: 136,560,710 T314A probably benign Het
Atp2c1 A T 9: 105,422,999 D700E probably damaging Het
Axin2 G A 11: 108,939,376 V341M possibly damaging Het
Bin3 A G 14: 70,134,527 Q139R probably damaging Het
Brca2 A G 5: 150,532,337 D181G probably damaging Het
C330027C09Rik T A 16: 49,001,653 S215T probably benign Het
Capn3 A G 2: 120,494,814 E466G probably damaging Het
Ccdc14 T A 16: 34,723,619 Y830* probably null Het
Cdk12 T C 11: 98,221,084 F723L unknown Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Clca2 T A 3: 145,098,784 I61F probably damaging Het
Clca4b T C 3: 144,922,768 T393A not run Het
Cldn5 G A 16: 18,777,095 A34T probably damaging Het
Cobll1 A T 2: 65,098,373 S870T probably damaging Het
Col12a1 T C 9: 79,706,360 K68E probably damaging Het
Crnn A T 3: 93,148,534 Q209L probably damaging Het
Cwf19l1 A T 19: 44,132,140 F45I probably damaging Het
Cyfip2 T A 11: 46,207,440 K1052* probably null Het
D930020B18Rik G A 10: 121,667,811 probably null Het
Dcc G A 18: 71,826,123 P193S probably damaging Het
Dda1 T A 8: 71,474,493 C48S probably benign Het
Disc1 A G 8: 125,155,041 R572G probably damaging Het
Dnah7a A T 1: 53,497,138 M2582K probably benign Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Dynlrb2 T C 8: 116,514,957 V80A probably benign Het
Eif3a A T 19: 60,766,644 D1033E unknown Het
Enam C A 5: 88,501,488 H285Q possibly damaging Het
Ep400 T C 5: 110,719,614 D980G unknown Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Erc2 A C 14: 28,040,389 D703A probably damaging Het
Ezh2 G T 6: 47,533,758 S639* probably null Het
Fbn1 G A 2: 125,352,049 H1333Y probably damaging Het
Flad1 A G 3: 89,408,665 S197P possibly damaging Het
Gfm2 G T 13: 97,143,021 C26F probably benign Het
Gm5294 A G 5: 138,820,981 H82R probably damaging Het
Gm597 A T 1: 28,780,152 M16K probably benign Het
Golga2 C T 2: 32,303,001 Q444* probably null Het
Gp5 A T 16: 30,308,608 V416D probably damaging Het
Gpat2 A G 2: 127,426,981 probably null Het
Gpr137c A G 14: 45,279,014 D353G probably damaging Het
Hoxa13 A C 6: 52,259,882 W133G probably damaging Het
Hydin A T 8: 110,557,662 I3189F probably damaging Het
Hydin A T 8: 110,601,273 K4804M probably damaging Het
Ice2 T C 9: 69,400,512 F26S probably damaging Het
Ints11 T C 4: 155,872,230 probably null Het
Ipo5 A G 14: 120,920,085 I112V probably benign Het
Itgax T A 7: 128,135,309 S346R probably damaging Het
Kcnj13 T A 1: 87,389,017 M125L probably damaging Het
Lmbrd1 T A 1: 24,744,867 V359E possibly damaging Het
Lrrc7 T G 3: 158,198,161 K287N probably damaging Het
Mau2 C T 8: 70,029,234 A191T possibly damaging Het
Mkx C A 18: 7,000,747 R65L possibly damaging Het
Mroh4 T A 15: 74,610,371 K746* probably null Het
Myh4 A G 11: 67,242,848 T238A probably damaging Het
Nlrp9c T A 7: 26,371,397 N920Y possibly damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Ntn4 T C 10: 93,644,804 L130P probably damaging Het
Olfr1240 A G 2: 89,440,198 V27A probably benign Het
Olfr1312 A T 2: 112,043,014 V6E possibly damaging Het
Olfr682-ps1 T A 7: 105,128,345 I21F probably benign Het
Olfr695 A G 7: 106,713,964 V239A probably benign Het
Olfr930 A T 9: 38,930,776 I202F probably damaging Het
Otog T C 7: 46,298,308 L110P probably damaging Het
Platr25 G A 13: 62,700,905 H48Y probably benign Het
Plcxd2 T C 16: 45,980,426 E145G probably damaging Het
Pltp A T 2: 164,854,322 N143K probably damaging Het
Pnpt1 T C 11: 29,161,334 Y735H probably damaging Het
Prom1 A G 5: 44,020,831 Y520H probably damaging Het
Rag2 A G 2: 101,630,773 Y476C probably damaging Het
Rdh16f2 A G 10: 127,877,024 Y297C probably damaging Het
Ryr1 T C 7: 29,085,755 E1844G probably benign Het
Ryr2 A G 13: 11,640,275 C3679R probably damaging Het
Sirt1 A G 10: 63,322,003 I544T probably benign Het
Sox2 C A 3: 34,650,972 P186Q possibly damaging Het
Tnpo3 A G 6: 29,556,996 L752P probably damaging Het
Top2b T A 14: 16,416,649 N1136K probably benign Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Ttf2 C A 3: 100,963,302 D152Y possibly damaging Het
Txndc15 T C 13: 55,714,788 L4P unknown Het
Unc5a T C 13: 54,996,573 V237A possibly damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vav3 C A 3: 109,628,099 P616T possibly damaging Het
Vmn2r15 T A 5: 109,293,239 D251V probably benign Het
Vmn2r15 A G 5: 109,297,522 L12S probably benign Het
Wfs1 A C 5: 36,967,732 I605S probably benign Het
Wif1 G A 10: 121,083,909 R187Q possibly damaging Het
Yipf1 A G 4: 107,350,541 probably null Het
Zdhhc20 G T 14: 57,873,920 F74L possibly damaging Het
Zfp507 T C 7: 35,776,418 T303A unknown Het
Zfp763 A T 17: 33,033,378 probably benign Het
Other mutations in Slc26a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Slc26a10 APN 10 127174177 splice site probably benign
IGL01657:Slc26a10 APN 10 127175034 missense probably damaging 1.00
R1202:Slc26a10 UTSW 10 127173348 missense probably damaging 0.99
R1844:Slc26a10 UTSW 10 127178410 missense probably damaging 0.97
R2423:Slc26a10 UTSW 10 127179737 critical splice acceptor site probably null
R4031:Slc26a10 UTSW 10 127178002 missense possibly damaging 0.57
R4779:Slc26a10 UTSW 10 127173355 missense possibly damaging 0.73
R5405:Slc26a10 UTSW 10 127174995 missense probably benign 0.09
R5478:Slc26a10 UTSW 10 127173949 missense probably benign 0.05
R5657:Slc26a10 UTSW 10 127174964 intron probably benign
R5990:Slc26a10 UTSW 10 127178758 missense possibly damaging 0.81
R6681:Slc26a10 UTSW 10 127173661 missense possibly damaging 0.93
R7083:Slc26a10 UTSW 10 127177168 missense probably damaging 1.00
R7997:Slc26a10 UTSW 10 127173309 missense possibly damaging 0.93
R8211:Slc26a10 UTSW 10 127173965 missense probably benign 0.06
R8268:Slc26a10 UTSW 10 127173622 critical splice donor site probably null
R8906:Slc26a10 UTSW 10 127180590 missense probably benign 0.02
Z1177:Slc26a10 UTSW 10 127179658 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATGAGGTTGGAGACACCGTG -3'
(R):5'- GTAAGAGAAAGACTTCGCCCAC -3'

Sequencing Primer
(F):5'- TGGGCCAGGAGTTCCTAG -3'
(R):5'- GAGAAAGACTTCGCCCACCTCTC -3'
Posted On2019-09-13