Incidental Mutation 'R7365:Zdhhc20'
ID571745
Institutional Source Beutler Lab
Gene Symbol Zdhhc20
Ensembl Gene ENSMUSG00000021969
Gene Namezinc finger, DHHC domain containing 20
SynonymsB230110O18Rik, ENSMUSG00000055956, 5033406L14Rik, 4930542A17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R7365 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location57832703-57890276 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 57873920 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 74 (F74L)
Ref Sequence ENSEMBL: ENSMUSP00000086900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089473] [ENSMUST00000226057]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089473
AA Change: F74L

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000086900
Gene: ENSMUSG00000021969
AA Change: F74L

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
Pfam:zf-DHHC 121 250 2.2e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000226057
AA Change: F74L

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (96/96)
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,562,936 S155G probably benign Het
Abcc4 T C 14: 118,627,654 N320S probably damaging Het
Akr1c19 G A 13: 4,237,070 R96H probably benign Het
Ankrd17 T C 5: 90,291,151 D451G possibly damaging Het
Ano8 T A 8: 71,485,110 D36V probably damaging Het
Aqp3 A G 4: 41,098,003 V36A probably benign Het
Atf7ip A G 6: 136,560,710 T314A probably benign Het
Atp2c1 A T 9: 105,422,999 D700E probably damaging Het
Axin2 G A 11: 108,939,376 V341M possibly damaging Het
Bin3 A G 14: 70,134,527 Q139R probably damaging Het
Brca2 A G 5: 150,532,337 D181G probably damaging Het
C330027C09Rik T A 16: 49,001,653 S215T probably benign Het
Capn3 A G 2: 120,494,814 E466G probably damaging Het
Ccdc14 T A 16: 34,723,619 Y830* probably null Het
Cdk12 T C 11: 98,221,084 F723L unknown Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Clca2 T A 3: 145,098,784 I61F probably damaging Het
Clca4b T C 3: 144,922,768 T393A not run Het
Cldn5 G A 16: 18,777,095 A34T probably damaging Het
Cobll1 A T 2: 65,098,373 S870T probably damaging Het
Col12a1 T C 9: 79,706,360 K68E probably damaging Het
Crnn A T 3: 93,148,534 Q209L probably damaging Het
Cwf19l1 A T 19: 44,132,140 F45I probably damaging Het
Cyfip2 T A 11: 46,207,440 K1052* probably null Het
D930020B18Rik G A 10: 121,667,811 probably null Het
Dcc G A 18: 71,826,123 P193S probably damaging Het
Dda1 T A 8: 71,474,493 C48S probably benign Het
Disc1 A G 8: 125,155,041 R572G probably damaging Het
Dnah7a A T 1: 53,497,138 M2582K probably benign Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Dynlrb2 T C 8: 116,514,957 V80A probably benign Het
Eif3a A T 19: 60,766,644 D1033E unknown Het
Enam C A 5: 88,501,488 H285Q possibly damaging Het
Ep400 T C 5: 110,719,614 D980G unknown Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Erc2 A C 14: 28,040,389 D703A probably damaging Het
Ezh2 G T 6: 47,533,758 S639* probably null Het
Fbn1 G A 2: 125,352,049 H1333Y probably damaging Het
Flad1 A G 3: 89,408,665 S197P possibly damaging Het
Gfm2 G T 13: 97,143,021 C26F probably benign Het
Gm5294 A G 5: 138,820,981 H82R probably damaging Het
Gm597 A T 1: 28,780,152 M16K probably benign Het
Golga2 C T 2: 32,303,001 Q444* probably null Het
Gp5 A T 16: 30,308,608 V416D probably damaging Het
Gpat2 A G 2: 127,426,981 probably null Het
Gpr137c A G 14: 45,279,014 D353G probably damaging Het
Hoxa13 A C 6: 52,259,882 W133G probably damaging Het
Hydin A T 8: 110,557,662 I3189F probably damaging Het
Hydin A T 8: 110,601,273 K4804M probably damaging Het
Ice2 T C 9: 69,400,512 F26S probably damaging Het
Ints11 T C 4: 155,872,230 probably null Het
Ipo5 A G 14: 120,920,085 I112V probably benign Het
Itgax T A 7: 128,135,309 S346R probably damaging Het
Kcnj13 T A 1: 87,389,017 M125L probably damaging Het
Lmbrd1 T A 1: 24,744,867 V359E possibly damaging Het
Lrrc7 T G 3: 158,198,161 K287N probably damaging Het
Mau2 C T 8: 70,029,234 A191T possibly damaging Het
Mkx C A 18: 7,000,747 R65L possibly damaging Het
Mroh4 T A 15: 74,610,371 K746* probably null Het
Myh4 A G 11: 67,242,848 T238A probably damaging Het
Nlrp9c T A 7: 26,371,397 N920Y possibly damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Ntn4 T C 10: 93,644,804 L130P probably damaging Het
Olfr1240 A G 2: 89,440,198 V27A probably benign Het
Olfr1312 A T 2: 112,043,014 V6E possibly damaging Het
Olfr682-ps1 T A 7: 105,128,345 I21F probably benign Het
Olfr695 A G 7: 106,713,964 V239A probably benign Het
Olfr930 A T 9: 38,930,776 I202F probably damaging Het
Otog T C 7: 46,298,308 L110P probably damaging Het
Platr25 G A 13: 62,700,905 H48Y probably benign Het
Plcxd2 T C 16: 45,980,426 E145G probably damaging Het
Pltp A T 2: 164,854,322 N143K probably damaging Het
Pnpt1 T C 11: 29,161,334 Y735H probably damaging Het
Prom1 A G 5: 44,020,831 Y520H probably damaging Het
Rag2 A G 2: 101,630,773 Y476C probably damaging Het
Rdh16f2 A G 10: 127,877,024 Y297C probably damaging Het
Ryr1 T C 7: 29,085,755 E1844G probably benign Het
Ryr2 A G 13: 11,640,275 C3679R probably damaging Het
Sirt1 A G 10: 63,322,003 I544T probably benign Het
Slc26a10 A T 10: 127,176,847 I382N possibly damaging Het
Sox2 C A 3: 34,650,972 P186Q possibly damaging Het
Tnpo3 A G 6: 29,556,996 L752P probably damaging Het
Top2b T A 14: 16,416,649 N1136K probably benign Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Ttf2 C A 3: 100,963,302 D152Y possibly damaging Het
Txndc15 T C 13: 55,714,788 L4P unknown Het
Unc5a T C 13: 54,996,573 V237A possibly damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vav3 C A 3: 109,628,099 P616T possibly damaging Het
Vmn2r15 T A 5: 109,293,239 D251V probably benign Het
Vmn2r15 A G 5: 109,297,522 L12S probably benign Het
Wfs1 A C 5: 36,967,732 I605S probably benign Het
Wif1 G A 10: 121,083,909 R187Q possibly damaging Het
Yipf1 A G 4: 107,350,541 probably null Het
Zfp507 T C 7: 35,776,418 T303A unknown Het
Zfp763 A T 17: 33,033,378 probably benign Het
Other mutations in Zdhhc20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Zdhhc20 APN 14 57873924 missense probably damaging 0.99
IGL00983:Zdhhc20 APN 14 57839156 missense possibly damaging 0.62
IGL01107:Zdhhc20 APN 14 57865589 missense probably damaging 1.00
IGL01350:Zdhhc20 APN 14 57873987 missense probably benign 0.03
IGL02572:Zdhhc20 APN 14 57890107 missense probably benign 0.20
IGL02748:Zdhhc20 APN 14 57858553 missense probably benign 0.08
IGL03406:Zdhhc20 APN 14 57839099 missense probably benign
R0314:Zdhhc20 UTSW 14 57856619 missense probably damaging 1.00
R0631:Zdhhc20 UTSW 14 57857640 missense probably damaging 0.99
R1144:Zdhhc20 UTSW 14 57856678 missense probably benign 0.07
R1703:Zdhhc20 UTSW 14 57839088 critical splice donor site probably null
R1815:Zdhhc20 UTSW 14 57890143 missense probably benign 0.10
R1816:Zdhhc20 UTSW 14 57890143 missense probably benign 0.10
R6219:Zdhhc20 UTSW 14 57840883 missense probably damaging 0.99
R6488:Zdhhc20 UTSW 14 57840832 missense probably benign 0.00
R6650:Zdhhc20 UTSW 14 57858575 missense probably damaging 1.00
R6790:Zdhhc20 UTSW 14 57890143 missense probably benign 0.00
R7196:Zdhhc20 UTSW 14 57873891 critical splice donor site probably null
R8126:Zdhhc20 UTSW 14 57846945 missense probably damaging 1.00
R8832:Zdhhc20 UTSW 14 57843264 missense possibly damaging 0.86
R8832:Zdhhc20 UTSW 14 57865632 missense probably benign 0.05
Z1176:Zdhhc20 UTSW 14 57839105 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTGAGAACAAGCCAATGAC -3'
(R):5'- CTCATGCTCTGAAATGCAAATACTGAG -3'

Sequencing Primer
(F):5'- GACTCACAGTCACATTACCAAGG -3'
(R):5'- GATCTCATGACCCAAGTACTG -3'
Posted On2019-09-13