Mutagenetix > Incidental Mutation

Incidental Mutation 'R7366:Sele'

571768

Institutional Source

Beutler Lab

Gene Symbol

Sele

Ensembl Gene

ENSMUSG00000026582

Gene Name

selectin, endothelial cell

Synonyms

CD62E, E-selectin, Elam

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R7366 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

164048234-164057677 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 164048719 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 12 (R12S)

Ref Sequence

ENSEMBL: ENSMUSP00000027874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027874]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000027874
AA Change: R12S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000027874
Gene: ENSMUSG00000026582
AA Change: R12S

Domain	Start	End	E-Value	Type
CLECT	21	146	1.45e-21	SMART
EGF	149	182	2.83e-5	SMART
CCP	187	245	1.49e-9	SMART
CCP	250	307	5.43e-12	SMART
CCP	312	370	1.82e-13	SMART
CCP	375	433	1.36e-12	SMART
CCP	438	496	6e-14	SMART
CCP	501	555	1.39e-9	SMART
transmembrane domain	565	587	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.1%

Validation Efficiency

99% (94/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in cytokine-stimulated endothelial cells and is thought to be responsible for the accumulation of blood leukocytes at sites of inflammation by mediating the adhesion of cells to the vascular lining. It exhibits structural features such as the presence of lectin- and EGF-like domains followed by short consensus repeat (SCR) domains that contain 6 conserved cysteine residues. These proteins are part of the selectin family of cell adhesion molecules. Adhesion molecules participate in the interaction between leukocytes and the endothelium and appear to be involved in the pathogenesis of atherosclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit mild defects in neutrophil infiltration during inflammatory responses. When combined with other selectin gene knockouts, more severe defects are present. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700023F06Rik	T	C	11: 103,208,118		probably null	Het
1700030K09Rik	C	T	8: 72,449,459	P244S	possibly damaging	Het
4930404N11Rik	T	C	10: 81,364,191	D165G	possibly damaging	Het
4930562C15Rik	A	G	16: 4,835,769	I61V	unknown	Het
Abcb11	C	T	2: 69,299,867	D282N	probably damaging	Het
Acbd3	A	G	1: 180,734,499	E181G	probably benign	Het
Ano3	T	C	2: 110,757,067	Y43C	probably damaging	Het
Aspa	T	A	11: 73,319,890		probably null	Het
AU018091	A	T	7: 3,156,330	N620K	probably damaging	Het
Bicc1	G	T	10: 70,943,386	T724K	probably benign	Het
Bmper	T	C	9: 23,484,004	I677T	probably damaging	Het
C3	T	A	17: 57,221,162	T686S	probably benign	Het
Cc2d2a	G	T	5: 43,729,990	R1315L	probably damaging	Het
Ccdc150	G	T	1: 54,300,382	E462*	probably null	Het
Ccdc88c	C	A	12: 100,944,950	R875L	possibly damaging	Het
Cd177	C	T	7: 24,756,722	G207D	probably damaging	Het
Cdh23	A	T	10: 60,315,692	Y2471*	probably null	Het
Cep89	G	A	7: 35,429,928	R630H	probably damaging	Het
Cmbl	A	T	15: 31,589,856	Y244F	probably benign	Het
Dcaf10	T	C	4: 45,373,919	V448A	probably damaging	Het
Ddr2	A	G	1: 169,997,964	W356R	probably damaging	Het
Depdc1a	A	G	3: 159,523,212	I534V	probably benign	Het
Dhtkd1	T	A	2: 5,917,906	I481L	probably benign	Het
Dlst	A	T	12: 85,128,315	I260L	probably benign	Het
Dnajc13	T	G	9: 104,184,706	K1350Q	probably benign	Het
Dpp4	T	C	2: 62,354,599	Y520C	probably damaging	Het
Dr1	C	A	5: 108,275,728	A127E	unknown	Het
Dsel	C	T	1: 111,861,573	G411S	probably damaging	Het
E130308A19Rik	T	C	4: 59,752,770	C628R	probably damaging	Het
Edem3	T	A	1: 151,812,614		probably null	Het
Fam20a	T	A	11: 109,673,342	Q528H	possibly damaging	Het
Fanca	T	C	8: 123,281,213	E981G	probably benign	Het
Fbp2	A	G	13: 62,837,198	V303A	possibly damaging	Het
Flii	C	T	11: 60,721,119	V353M	possibly damaging	Het
Gm10277	T	A	11: 77,785,758	Y129F	unknown	Het
Gm3159	A	T	14: 4,398,525	H72L	probably benign	Het
Gm5114	T	G	7: 39,409,344	T284P	possibly damaging	Het
Gm7168	T	C	17: 13,949,885	S505P	probably damaging	Het
Gnal	T	C	18: 67,211,071	V239A	possibly damaging	Het
Gtf2i	C	T	5: 134,265,749	E370K	probably damaging	Het
Hivep3	CGG	CG	4: 120,097,911	1141	probably null	Het
Il3	T	A	11: 54,265,883	R93S	probably benign	Het
Itsn1	A	G	16: 91,908,450	E1573G	unknown	Het
Kif26a	G	A	12: 112,163,542		probably null	Het
Klb	T	C	5: 65,372,431	M434T	probably damaging	Het
Lrp2	T	A	2: 69,483,806	R2194W	probably damaging	Het
Lrp6	G	T	6: 134,450,818	P1604T	probably damaging	Het
Mak16	A	G	8: 31,166,099	Y119H	possibly damaging	Het
Map3k19	T	A	1: 127,817,455	M1421L	probably damaging	Het
Mbd5	A	G	2: 49,274,568	I1186V	probably benign	Het
Mboat1	T	A	13: 30,202,362	C120S	possibly damaging	Het
Mctp2	T	A	7: 72,259,214	D117V	probably benign	Het
Mocos	C	A	18: 24,676,616	N425K	probably damaging	Het
Nav2	A	G	7: 49,554,203		probably null	Het
Ngfr	A	T	11: 95,574,429	W198R	possibly damaging	Het
Nr4a3	T	G	4: 48,051,290	S15A	possibly damaging	Het
Obsl1	T	C	1: 75,502,964	S596G	probably damaging	Het
Olfr111	T	A	17: 37,530,817	V280D	probably damaging	Het
Olfr1414	A	G	1: 92,511,678	S117P	possibly damaging	Het
Olfr578	A	T	7: 102,984,516	I216K	probably damaging	Het
Olfr594	T	G	7: 103,220,533	Y272D	probably benign	Het
Olfr705	G	T	7: 106,873,396	P283Q	probably damaging	Het
Pithd1	T	C	4: 135,987,050	Y29C	probably benign	Het
Plcb3	T	C	19: 6,962,021	T530A	probably benign	Het
Prss40	A	T	1: 34,559,871	Y70*	probably null	Het
Ralgps1	T	C	2: 33,324,688	M61V	possibly damaging	Het
Rbp4	C	T	19: 38,124,962	R36H	possibly damaging	Het
Rnf125	A	G	18: 20,974,433	N7S	not run	Het
Rpe65	G	A	3: 159,624,729	S511N	probably benign	Het
Rspo4	A	T	2: 151,867,873	Y66F	probably damaging	Het
Ruvbl2	A	G	7: 45,422,149	S437P	probably benign	Het
Sgo2b	T	A	8: 63,938,417	K139*	probably null	Het
Shroom3	C	A	5: 92,964,606	S1942*	probably null	Het
Slc12a9	G	A	5: 137,328,623	R191*	probably null	Het
Spag9	G	T	11: 94,108,521	V1088L	possibly damaging	Het
Sptb	T	G	12: 76,604,194	D1669A	probably damaging	Het
Sptlc2	A	G	12: 87,314,049		probably null	Het
Sult2a8	A	T	7: 14,416,329		probably null	Het
Synpo2	A	G	3: 123,114,041	V542A	probably damaging	Het
Tecpr2	T	C	12: 110,915,480		probably null	Het
Tenm2	T	C	11: 36,069,414	T1029A	probably benign	Het
Tgoln1	G	C	6: 72,616,278	T73R	probably benign	Het
Tnfaip8l1	C	A	17: 56,171,897	N62K	probably damaging	Het
Tollip	A	G	7: 141,889,597	S174P	probably benign	Het
Trp53tg5	A	G	2: 164,471,107	I216T	possibly damaging	Het
Tssk5	A	G	15: 76,374,513	S58P	probably benign	Het
Ttc9b	T	C	7: 27,654,959	Y157H	probably damaging	Het
Tuba8	A	G	6: 121,222,912	Y185C	probably damaging	Het
Ubr2	C	T	17: 46,955,845	A1127T	probably damaging	Het
Urb1	CACTTAC	CAC	16: 90,772,573		probably benign	Het
Yipf3	T	A	17: 46,248,929	L57Q	possibly damaging	Het
Zbtb32	A	C	7: 30,590,181	C19G	probably damaging	Het
Zfp735	A	T	11: 73,712,153	H641L	possibly damaging	Het
Zfyve28	A	T	5: 34,232,227	Y210N	probably damaging	Het
Zpr1	T	A	9: 46,273,373		probably null	Het

Other mutations in Sele

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00233:Sele	APN	1	164051834	missense	probably damaging	1.00
IGL02097:Sele	APN	1	164053093	missense	probably benign	0.02
IGL02243:Sele	APN	1	164052968	missense	probably benign	0.01
IGL02688:Sele	APN	1	164050130	missense	probably damaging	1.00
IGL03022:Sele	APN	1	164054679	missense	probably benign	0.01
R0433:Sele	UTSW	1	164049244	missense	possibly damaging	0.74
R0487:Sele	UTSW	1	164053615	nonsense	probably null
R0678:Sele	UTSW	1	164054729	critical splice donor site	probably null
R1295:Sele	UTSW	1	164050810	missense	probably damaging	1.00
R1296:Sele	UTSW	1	164050810	missense	probably damaging	1.00
R1532:Sele	UTSW	1	164053851	missense	probably benign	0.29
R1730:Sele	UTSW	1	164054623	missense	probably benign
R2102:Sele	UTSW	1	164053826	missense	probably damaging	1.00
R2384:Sele	UTSW	1	164050775	missense	probably benign	0.00
R3001:Sele	UTSW	1	164053571	missense	probably damaging	1.00
R3002:Sele	UTSW	1	164053571	missense	probably damaging	1.00
R5851:Sele	UTSW	1	164049574	missense	probably benign	0.06
R6164:Sele	UTSW	1	164051817	splice site	probably null
R6239:Sele	UTSW	1	164050808	missense	probably damaging	0.98
R6406:Sele	UTSW	1	164050743	missense	probably damaging	1.00
R6411:Sele	UTSW	1	164049415	missense	probably benign	0.03
R6731:Sele	UTSW	1	164053673	missense	probably damaging	1.00
R6851:Sele	UTSW	1	164053952	missense	probably damaging	1.00
R7291:Sele	UTSW	1	164053868	missense	possibly damaging	0.89
R7328:Sele	UTSW	1	164049275	missense	probably benign	0.23
R7393:Sele	UTSW	1	164053923	missense	probably benign	0.05
R7431:Sele	UTSW	1	164051620	missense	probably damaging	0.99
R7603:Sele	UTSW	1	164049515	missense	probably damaging	1.00
R7803:Sele	UTSW	1	164050694	missense	possibly damaging	0.88
R7807:Sele	UTSW	1	164053893	missense	probably benign	0.05
R8323:Sele	UTSW	1	164051638	missense	possibly damaging	0.59
R9018:Sele	UTSW	1	164053679	missense	probably damaging	1.00
R9310:Sele	UTSW	1	164049406	missense	probably benign	0.04
R9630:Sele	UTSW	1	164051954	missense	probably damaging	0.99
X0005:Sele	UTSW	1	164049343	missense	probably damaging	1.00
X0021:Sele	UTSW	1	164053611	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- TGCTAGATGCCTGTGAAATAAGGG -3'
(R):5'- GCCAGATGAACGACTCTTCAC -3'

Sequencing Primer
(F):5'- GATGAGGTACAGGATTCTAAAACCTC -3'
(R):5'- GATGAACGACTCTTCACAAAGC -3'

Posted On

2019-09-13