Incidental Mutation 'R7366:Ddr2'
ID571769
Institutional Source Beutler Lab
Gene Symbol Ddr2
Ensembl Gene ENSMUSG00000026674
Gene Namediscoidin domain receptor family, member 2
SynonymsNtrkr3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7366 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location169972307-170110762 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 169997964 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 356 (W356R)
Ref Sequence ENSEMBL: ENSMUSP00000027985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027985] [ENSMUST00000170800] [ENSMUST00000194690]
Predicted Effect probably damaging
Transcript: ENSMUST00000027985
AA Change: W356R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027985
Gene: ENSMUSG00000026674
AA Change: W356R

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
FA58C 29 185 2.39e-43 SMART
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
TyrKc 563 848 1.08e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170800
AA Change: W356R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129624
Gene: ENSMUSG00000026674
AA Change: W356R

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
FA58C 29 185 2.39e-43 SMART
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
TyrKc 563 848 1.08e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000194690
AA Change: W356R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141443
Gene: ENSMUSG00000026674
AA Change: W356R

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
FA58C 29 185 2.39e-43 SMART
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
TyrKc 563 848 1.08e-133 SMART
Meta Mutation Damage Score 0.9058 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.1%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Receptor tyrosine kinases (RTKs) play a key role in the communication of cells with their microenvironment. These molecules are involved in the regulation of cell growth, differentiation, and metabolism. In several cases the biochemical mechanism by which RTKs transduce signals across the membrane has been shown to be ligand induced receptor oligomerization and subsequent intracellular phosphorylation. This autophosphorylation leads to phosphorylation of cytosolic targets as well as association with other molecules, which are involved in pleiotropic effects of signal transduction. RTKs have a tripartite structure with extracellular, transmembrane, and cytoplasmic regions. This gene encodes a member of a novel subclass of RTKs and contains a distinct extracellular region encompassing a factor VIII-like domain. Alternative splicing in the 5' UTR results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show dwarfism, reduced chondrocyte proliferation, shortened long bones and snout, and skull anomalies. Homozygotes for another null allele show similar skeletal defects, small hearts, short cardiomyocytes, lower cardiac collagen density, and altered cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,208,118 probably null Het
1700030K09Rik C T 8: 72,449,459 P244S possibly damaging Het
4930404N11Rik T C 10: 81,364,191 D165G possibly damaging Het
4930562C15Rik A G 16: 4,835,769 I61V unknown Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Acbd3 A G 1: 180,734,499 E181G probably benign Het
Ano3 T C 2: 110,757,067 Y43C probably damaging Het
Aspa T A 11: 73,319,890 probably null Het
AU018091 A T 7: 3,156,330 N620K probably damaging Het
Bicc1 G T 10: 70,943,386 T724K probably benign Het
Bmper T C 9: 23,484,004 I677T probably damaging Het
C3 T A 17: 57,221,162 T686S probably benign Het
Cc2d2a G T 5: 43,729,990 R1315L probably damaging Het
Ccdc150 G T 1: 54,300,382 E462* probably null Het
Ccdc88c C A 12: 100,944,950 R875L possibly damaging Het
Cd177 C T 7: 24,756,722 G207D probably damaging Het
Cdh23 A T 10: 60,315,692 Y2471* probably null Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cmbl A T 15: 31,589,856 Y244F probably benign Het
Dcaf10 T C 4: 45,373,919 V448A probably damaging Het
Depdc1a A G 3: 159,523,212 I534V probably benign Het
Dhtkd1 T A 2: 5,917,906 I481L probably benign Het
Dlst A T 12: 85,128,315 I260L probably benign Het
Dnajc13 T G 9: 104,184,706 K1350Q probably benign Het
Dpp4 T C 2: 62,354,599 Y520C probably damaging Het
Dr1 C A 5: 108,275,728 A127E unknown Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
E130308A19Rik T C 4: 59,752,770 C628R probably damaging Het
Edem3 T A 1: 151,812,614 probably null Het
Fam20a T A 11: 109,673,342 Q528H possibly damaging Het
Fanca T C 8: 123,281,213 E981G probably benign Het
Fbp2 A G 13: 62,837,198 V303A possibly damaging Het
Flii C T 11: 60,721,119 V353M possibly damaging Het
Gm10277 T A 11: 77,785,758 Y129F unknown Het
Gm3159 A T 14: 4,398,525 H72L probably benign Het
Gm5114 T G 7: 39,409,344 T284P possibly damaging Het
Gm7168 T C 17: 13,949,885 S505P probably damaging Het
Gnal T C 18: 67,211,071 V239A possibly damaging Het
Gtf2i C T 5: 134,265,749 E370K probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Il3 T A 11: 54,265,883 R93S probably benign Het
Itsn1 A G 16: 91,908,450 E1573G unknown Het
Kif26a G A 12: 112,163,542 probably null Het
Klb T C 5: 65,372,431 M434T probably damaging Het
Lrp2 T A 2: 69,483,806 R2194W probably damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Mak16 A G 8: 31,166,099 Y119H possibly damaging Het
Map3k19 T A 1: 127,817,455 M1421L probably damaging Het
Mbd5 A G 2: 49,274,568 I1186V probably benign Het
Mboat1 T A 13: 30,202,362 C120S possibly damaging Het
Mctp2 T A 7: 72,259,214 D117V probably benign Het
Mocos C A 18: 24,676,616 N425K probably damaging Het
Nav2 A G 7: 49,554,203 probably null Het
Ngfr A T 11: 95,574,429 W198R possibly damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Obsl1 T C 1: 75,502,964 S596G probably damaging Het
Olfr111 T A 17: 37,530,817 V280D probably damaging Het
Olfr1414 A G 1: 92,511,678 S117P possibly damaging Het
Olfr578 A T 7: 102,984,516 I216K probably damaging Het
Olfr594 T G 7: 103,220,533 Y272D probably benign Het
Olfr705 G T 7: 106,873,396 P283Q probably damaging Het
Pithd1 T C 4: 135,987,050 Y29C probably benign Het
Plcb3 T C 19: 6,962,021 T530A probably benign Het
Prss40 A T 1: 34,559,871 Y70* probably null Het
Ralgps1 T C 2: 33,324,688 M61V possibly damaging Het
Rbp4 C T 19: 38,124,962 R36H possibly damaging Het
Rnf125 A G 18: 20,974,433 N7S not run Het
Rpe65 G A 3: 159,624,729 S511N probably benign Het
Rspo4 A T 2: 151,867,873 Y66F probably damaging Het
Ruvbl2 A G 7: 45,422,149 S437P probably benign Het
Sele C A 1: 164,048,719 R12S probably benign Het
Sgo2b T A 8: 63,938,417 K139* probably null Het
Shroom3 C A 5: 92,964,606 S1942* probably null Het
Slc12a9 G A 5: 137,328,623 R191* probably null Het
Spag9 G T 11: 94,108,521 V1088L possibly damaging Het
Sptb T G 12: 76,604,194 D1669A probably damaging Het
Sptlc2 A G 12: 87,314,049 probably null Het
Sult2a8 A T 7: 14,416,329 probably null Het
Synpo2 A G 3: 123,114,041 V542A probably damaging Het
Tecpr2 T C 12: 110,915,480 probably null Het
Tenm2 T C 11: 36,069,414 T1029A probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tnfaip8l1 C A 17: 56,171,897 N62K probably damaging Het
Tollip A G 7: 141,889,597 S174P probably benign Het
Trp53tg5 A G 2: 164,471,107 I216T possibly damaging Het
Tssk5 A G 15: 76,374,513 S58P probably benign Het
Ttc9b T C 7: 27,654,959 Y157H probably damaging Het
Tuba8 A G 6: 121,222,912 Y185C probably damaging Het
Ubr2 C T 17: 46,955,845 A1127T probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Yipf3 T A 17: 46,248,929 L57Q possibly damaging Het
Zbtb32 A C 7: 30,590,181 C19G probably damaging Het
Zfp735 A T 11: 73,712,153 H641L possibly damaging Het
Zfyve28 A T 5: 34,232,227 Y210N probably damaging Het
Zpr1 T A 9: 46,273,373 probably null Het
Other mutations in Ddr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ddr2 APN 1 169984427 missense possibly damaging 0.95
IGL00432:Ddr2 APN 1 169997958 missense probably benign 0.11
IGL00490:Ddr2 APN 1 170005194 missense probably damaging 1.00
IGL01343:Ddr2 APN 1 169984581 missense probably benign
IGL01898:Ddr2 APN 1 169998156 missense possibly damaging 0.85
IGL01899:Ddr2 APN 1 169984422 missense probably damaging 1.00
IGL01906:Ddr2 APN 1 169982099 missense probably damaging 1.00
IGL02115:Ddr2 APN 1 169994709 missense probably benign
IGL02330:Ddr2 APN 1 169988524 missense probably damaging 0.99
IGL02740:Ddr2 APN 1 169984945 missense probably damaging 1.00
IGL02828:Ddr2 APN 1 169988513 missense probably benign 0.34
built UTSW 1 169997964 missense probably damaging 1.00
debulked UTSW 1 169982098 missense probably damaging 1.00
fibro UTSW 1 170004812 splice site probably benign
fingers UTSW 1 169988540 missense probably benign 0.16
Julio UTSW 1 169997929 critical splice donor site probably null
phalanges UTSW 1 170005240 nonsense probably null
revolta UTSW 1 169988520 nonsense probably null
R0574:Ddr2 UTSW 1 169981963 splice site probably benign
R0730:Ddr2 UTSW 1 169995566 missense probably benign
R0733:Ddr2 UTSW 1 170004812 splice site probably benign
R0883:Ddr2 UTSW 1 169994629 missense probably benign 0.01
R1340:Ddr2 UTSW 1 169998084 missense probably benign
R1815:Ddr2 UTSW 1 169995601 nonsense probably null
R1921:Ddr2 UTSW 1 170004245 missense probably damaging 1.00
R1924:Ddr2 UTSW 1 169982072 missense probably benign 0.01
R2016:Ddr2 UTSW 1 169984968 missense probably damaging 1.00
R2079:Ddr2 UTSW 1 170004776 nonsense probably null
R2178:Ddr2 UTSW 1 169994682 missense probably benign 0.18
R2903:Ddr2 UTSW 1 169998161 missense probably damaging 1.00
R3051:Ddr2 UTSW 1 169988455 missense probably benign 0.01
R3971:Ddr2 UTSW 1 169988417 missense probably damaging 1.00
R4290:Ddr2 UTSW 1 169990609 missense probably benign 0.00
R4494:Ddr2 UTSW 1 169988414 missense probably damaging 1.00
R4606:Ddr2 UTSW 1 170001852 missense probably benign 0.05
R4721:Ddr2 UTSW 1 170005240 nonsense probably null
R4734:Ddr2 UTSW 1 169998088 missense probably benign 0.41
R4855:Ddr2 UTSW 1 169988497 missense possibly damaging 0.94
R4871:Ddr2 UTSW 1 170004771 missense probably benign 0.19
R4923:Ddr2 UTSW 1 169997929 critical splice donor site probably null
R5207:Ddr2 UTSW 1 169984961 missense probably damaging 1.00
R5325:Ddr2 UTSW 1 170001837 missense probably benign 0.00
R5439:Ddr2 UTSW 1 170004729 missense possibly damaging 0.92
R5723:Ddr2 UTSW 1 169988520 nonsense probably null
R5833:Ddr2 UTSW 1 170004696 missense probably benign 0.01
R5924:Ddr2 UTSW 1 169994628 missense probably benign 0.03
R6020:Ddr2 UTSW 1 170005102 missense probably benign 0.15
R6270:Ddr2 UTSW 1 169988540 missense probably benign 0.16
R6326:Ddr2 UTSW 1 169987140 missense probably damaging 1.00
R6328:Ddr2 UTSW 1 169987065 missense possibly damaging 0.52
R6794:Ddr2 UTSW 1 169982098 missense probably damaging 1.00
R6925:Ddr2 UTSW 1 169998132 missense probably benign 0.01
R7011:Ddr2 UTSW 1 169982103 missense probably damaging 1.00
R7185:Ddr2 UTSW 1 169987054 missense probably damaging 1.00
R7248:Ddr2 UTSW 1 169994629 missense probably benign 0.01
R7278:Ddr2 UTSW 1 169984961 missense probably damaging 1.00
R7343:Ddr2 UTSW 1 169982078 missense probably damaging 1.00
R7520:Ddr2 UTSW 1 169984439 missense probably damaging 1.00
R7571:Ddr2 UTSW 1 170001851 missense probably benign 0.05
R7611:Ddr2 UTSW 1 169998158 missense possibly damaging 0.73
X0004:Ddr2 UTSW 1 169987098 missense probably benign 0.10
X0027:Ddr2 UTSW 1 169982030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTGTACTGTTCCACTCTGG -3'
(R):5'- AGGAGGTCCAGTGCTACTTTC -3'

Sequencing Primer
(F):5'- GAAACACAAAGGATTCTCTCTTTCC -3'
(R):5'- CAGTGCTACTTTCGCTCGGAAG -3'
Posted On2019-09-13