Incidental Mutation 'R7366:Dpp4'
ID571774
Institutional Source Beutler Lab
Gene Symbol Dpp4
Ensembl Gene ENSMUSG00000035000
Gene Namedipeptidylpeptidase 4
SynonymsDpp-4, THAM, Cd26
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7366 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location62330073-62412231 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62354599 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 520 (Y520C)
Ref Sequence ENSEMBL: ENSMUSP00000044050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047812]
Predicted Effect probably damaging
Transcript: ENSMUST00000047812
AA Change: Y520C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044050
Gene: ENSMUSG00000035000
AA Change: Y520C

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DPPIV_N 102 473 5.7e-110 PFAM
Pfam:Abhydrolase_5 545 752 1e-11 PFAM
Pfam:DLH 546 754 4e-7 PFAM
Pfam:Peptidase_S9 551 760 3.4e-61 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.1%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is identical to adenosine deaminase complexing protein-2, and to the T-cell activation antigen CD26. It is an intrinsic membrane glycoprotein and a serine exopeptidase that cleaves X-proline dipeptides from the N-terminus of polypeptides. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show hypoglycemia, hyperinsulinemia, and increased plasma glucagon-like peptide 1 in glucose tolerance tests. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,208,118 probably null Het
1700030K09Rik C T 8: 72,449,459 P244S possibly damaging Het
4930404N11Rik T C 10: 81,364,191 D165G possibly damaging Het
4930562C15Rik A G 16: 4,835,769 I61V unknown Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Acbd3 A G 1: 180,734,499 E181G probably benign Het
Ano3 T C 2: 110,757,067 Y43C probably damaging Het
Aspa T A 11: 73,319,890 probably null Het
AU018091 A T 7: 3,156,330 N620K probably damaging Het
Bicc1 G T 10: 70,943,386 T724K probably benign Het
Bmper T C 9: 23,484,004 I677T probably damaging Het
C3 T A 17: 57,221,162 T686S probably benign Het
Cc2d2a G T 5: 43,729,990 R1315L probably damaging Het
Ccdc150 G T 1: 54,300,382 E462* probably null Het
Ccdc88c C A 12: 100,944,950 R875L possibly damaging Het
Cd177 C T 7: 24,756,722 G207D probably damaging Het
Cdh23 A T 10: 60,315,692 Y2471* probably null Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cmbl A T 15: 31,589,856 Y244F probably benign Het
Dcaf10 T C 4: 45,373,919 V448A probably damaging Het
Ddr2 A G 1: 169,997,964 W356R probably damaging Het
Depdc1a A G 3: 159,523,212 I534V probably benign Het
Dhtkd1 T A 2: 5,917,906 I481L probably benign Het
Dlst A T 12: 85,128,315 I260L probably benign Het
Dnajc13 T G 9: 104,184,706 K1350Q probably benign Het
Dr1 C A 5: 108,275,728 A127E unknown Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
E130308A19Rik T C 4: 59,752,770 C628R probably damaging Het
Edem3 T A 1: 151,812,614 probably null Het
Fam20a T A 11: 109,673,342 Q528H possibly damaging Het
Fanca T C 8: 123,281,213 E981G probably benign Het
Fbp2 A G 13: 62,837,198 V303A possibly damaging Het
Flii C T 11: 60,721,119 V353M possibly damaging Het
Gm10277 T A 11: 77,785,758 Y129F unknown Het
Gm3159 A T 14: 4,398,525 H72L probably benign Het
Gm5114 T G 7: 39,409,344 T284P possibly damaging Het
Gm7168 T C 17: 13,949,885 S505P probably damaging Het
Gnal T C 18: 67,211,071 V239A possibly damaging Het
Gtf2i C T 5: 134,265,749 E370K probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Il3 T A 11: 54,265,883 R93S probably benign Het
Itsn1 A G 16: 91,908,450 E1573G unknown Het
Kif26a G A 12: 112,163,542 probably null Het
Klb T C 5: 65,372,431 M434T probably damaging Het
Lrp2 T A 2: 69,483,806 R2194W probably damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Mak16 A G 8: 31,166,099 Y119H possibly damaging Het
Map3k19 T A 1: 127,817,455 M1421L probably damaging Het
Mbd5 A G 2: 49,274,568 I1186V probably benign Het
Mboat1 T A 13: 30,202,362 C120S possibly damaging Het
Mctp2 T A 7: 72,259,214 D117V probably benign Het
Mocos C A 18: 24,676,616 N425K probably damaging Het
Nav2 A G 7: 49,554,203 probably null Het
Ngfr A T 11: 95,574,429 W198R possibly damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Obsl1 T C 1: 75,502,964 S596G probably damaging Het
Olfr111 T A 17: 37,530,817 V280D probably damaging Het
Olfr1414 A G 1: 92,511,678 S117P possibly damaging Het
Olfr578 A T 7: 102,984,516 I216K probably damaging Het
Olfr594 T G 7: 103,220,533 Y272D probably benign Het
Olfr705 G T 7: 106,873,396 P283Q probably damaging Het
Pithd1 T C 4: 135,987,050 Y29C probably benign Het
Plcb3 T C 19: 6,962,021 T530A probably benign Het
Prss40 A T 1: 34,559,871 Y70* probably null Het
Ralgps1 T C 2: 33,324,688 M61V possibly damaging Het
Rbp4 C T 19: 38,124,962 R36H possibly damaging Het
Rnf125 A G 18: 20,974,433 N7S not run Het
Rpe65 G A 3: 159,624,729 S511N probably benign Het
Rspo4 A T 2: 151,867,873 Y66F probably damaging Het
Ruvbl2 A G 7: 45,422,149 S437P probably benign Het
Sele C A 1: 164,048,719 R12S probably benign Het
Sgo2b T A 8: 63,938,417 K139* probably null Het
Shroom3 C A 5: 92,964,606 S1942* probably null Het
Slc12a9 G A 5: 137,328,623 R191* probably null Het
Spag9 G T 11: 94,108,521 V1088L possibly damaging Het
Sptb T G 12: 76,604,194 D1669A probably damaging Het
Sptlc2 A G 12: 87,314,049 probably null Het
Sult2a8 A T 7: 14,416,329 probably null Het
Synpo2 A G 3: 123,114,041 V542A probably damaging Het
Tecpr2 T C 12: 110,915,480 probably null Het
Tenm2 T C 11: 36,069,414 T1029A probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tnfaip8l1 C A 17: 56,171,897 N62K probably damaging Het
Tollip A G 7: 141,889,597 S174P probably benign Het
Trp53tg5 A G 2: 164,471,107 I216T possibly damaging Het
Tssk5 A G 15: 76,374,513 S58P probably benign Het
Ttc9b T C 7: 27,654,959 Y157H probably damaging Het
Tuba8 A G 6: 121,222,912 Y185C probably damaging Het
Ubr2 C T 17: 46,955,845 A1127T probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Yipf3 T A 17: 46,248,929 L57Q possibly damaging Het
Zbtb32 A C 7: 30,590,181 C19G probably damaging Het
Zfp735 A T 11: 73,712,153 H641L possibly damaging Het
Zfyve28 A T 5: 34,232,227 Y210N probably damaging Het
Zpr1 T A 9: 46,273,373 probably null Het
Other mutations in Dpp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Dpp4 APN 2 62379302 missense probably damaging 1.00
IGL02205:Dpp4 APN 2 62352257 missense probably damaging 1.00
IGL02276:Dpp4 APN 2 62356951 splice site probably benign
IGL02335:Dpp4 APN 2 62334644 missense probably benign 0.03
IGL02615:Dpp4 APN 2 62359328 missense probably damaging 1.00
IGL02639:Dpp4 APN 2 62352240 missense probably benign
IGL02972:Dpp4 APN 2 62352225 missense probably damaging 1.00
IGL03366:Dpp4 APN 2 62356957 splice site probably null
caribou UTSW 2 62347901 missense possibly damaging 0.69
PIT4449001:Dpp4 UTSW 2 62356644 missense probably benign 0.00
R0502:Dpp4 UTSW 2 62364988 missense probably damaging 0.99
R0581:Dpp4 UTSW 2 62356676 missense probably benign
R1004:Dpp4 UTSW 2 62332640 missense probably benign 0.08
R1075:Dpp4 UTSW 2 62352286 missense probably benign 0.39
R1476:Dpp4 UTSW 2 62347901 missense possibly damaging 0.69
R1702:Dpp4 UTSW 2 62386429 critical splice donor site probably null
R1707:Dpp4 UTSW 2 62359335 splice site probably benign
R1733:Dpp4 UTSW 2 62372869 critical splice acceptor site probably null
R1899:Dpp4 UTSW 2 62345050 splice site probably benign
R2264:Dpp4 UTSW 2 62378239 missense possibly damaging 0.71
R2496:Dpp4 UTSW 2 62387133 missense possibly damaging 0.90
R3765:Dpp4 UTSW 2 62386436 missense probably benign 0.17
R4278:Dpp4 UTSW 2 62379323 missense probably damaging 1.00
R4413:Dpp4 UTSW 2 62387140 missense possibly damaging 0.89
R4432:Dpp4 UTSW 2 62345112 missense probably damaging 1.00
R4647:Dpp4 UTSW 2 62334605 missense probably damaging 1.00
R4710:Dpp4 UTSW 2 62360315 missense probably benign 0.04
R4914:Dpp4 UTSW 2 62347892 missense probably benign 0.20
R5173:Dpp4 UTSW 2 62387130 missense probably damaging 1.00
R5283:Dpp4 UTSW 2 62360336 missense probably damaging 1.00
R5698:Dpp4 UTSW 2 62334311 missense probably damaging 1.00
R6621:Dpp4 UTSW 2 62352140 missense probably damaging 1.00
R6681:Dpp4 UTSW 2 62348549 missense probably benign 0.01
R6739:Dpp4 UTSW 2 62387095 missense probably benign
R6962:Dpp4 UTSW 2 62372830 missense probably benign 0.11
R7249:Dpp4 UTSW 2 62385203 missense probably benign 0.14
R7268:Dpp4 UTSW 2 62347842 missense probably damaging 1.00
R7343:Dpp4 UTSW 2 62358901 nonsense probably null
R7357:Dpp4 UTSW 2 62387077 missense probably benign
R7413:Dpp4 UTSW 2 62356989 missense probably damaging 1.00
R7431:Dpp4 UTSW 2 62352238 missense probably benign 0.01
R7642:Dpp4 UTSW 2 62360283 critical splice donor site probably null
R8004:Dpp4 UTSW 2 62358828 missense probably benign 0.00
R8197:Dpp4 UTSW 2 62372827 missense probably benign 0.31
R8341:Dpp4 UTSW 2 62347890 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AAAACACAGCTGGGATTTGTAG -3'
(R):5'- CCTTATGAACAACGCAGCTGG -3'

Sequencing Primer
(F):5'- CAGCTGGGATTTGTAGGTACAAGAC -3'
(R):5'- GAACAACGCAGCTGGCTTTTATATC -3'
Posted On2019-09-13