Mutagenetix > Incidental Mutation

Incidental Mutation 'R7366:Abcb11'

571775

Institutional Source

Beutler Lab

Gene Symbol

Abcb11

Ensembl Gene

ENSMUSG00000027048

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 11

Synonyms

PFIC2, Bsep, PGY4, Lith1, ABC16, sister of P-glycoprotein

MMRRC Submission

Accession Numbers

Genbank: NM_021022; MGI: 1351619

Essential gene?

Possibly essential (E-score: 0.602) question?

Stock #

R7366 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

69238282-69342616 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 69299867 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 282 (D282N)

Ref Sequence

ENSEMBL: ENSMUSP00000099771 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]

AlphaFold

Q9QY30

Predicted Effect

probably damaging
Transcript: ENSMUST00000102709
AA Change: D282N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048
AA Change: D282N

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	373	1.3e-65	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1031	2.7e-55	PFAM
AAA	1105	1299	1.9e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102710
AA Change: D282N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048
AA Change: D282N

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	371	1.7e-72	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1029	3.2e-59	PFAM
AAA	1105	1299	1.9e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000180142
AA Change: D282N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048
AA Change: D282N

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	371	1.4e-72	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1029	2.5e-59	PFAM
AAA	1105	1299	1.9e-17	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.1%

Validation Efficiency

99% (94/95)

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700023F06Rik	T	C	11: 103,208,118		probably null	Het
1700030K09Rik	C	T	8: 72,449,459	P244S	possibly damaging	Het
4930404N11Rik	T	C	10: 81,364,191	D165G	possibly damaging	Het
4930562C15Rik	A	G	16: 4,835,769	I61V	unknown	Het
Acbd3	A	G	1: 180,734,499	E181G	probably benign	Het
Ano3	T	C	2: 110,757,067	Y43C	probably damaging	Het
Aspa	T	A	11: 73,319,890		probably null	Het
AU018091	A	T	7: 3,156,330	N620K	probably damaging	Het
Bicc1	G	T	10: 70,943,386	T724K	probably benign	Het
Bmper	T	C	9: 23,484,004	I677T	probably damaging	Het
C3	T	A	17: 57,221,162	T686S	probably benign	Het
Cc2d2a	G	T	5: 43,729,990	R1315L	probably damaging	Het
Ccdc150	G	T	1: 54,300,382	E462*	probably null	Het
Ccdc88c	C	A	12: 100,944,950	R875L	possibly damaging	Het
Cd177	C	T	7: 24,756,722	G207D	probably damaging	Het
Cdh23	A	T	10: 60,315,692	Y2471*	probably null	Het
Cep89	G	A	7: 35,429,928	R630H	probably damaging	Het
Cmbl	A	T	15: 31,589,856	Y244F	probably benign	Het
Dcaf10	T	C	4: 45,373,919	V448A	probably damaging	Het
Ddr2	A	G	1: 169,997,964	W356R	probably damaging	Het
Depdc1a	A	G	3: 159,523,212	I534V	probably benign	Het
Dhtkd1	T	A	2: 5,917,906	I481L	probably benign	Het
Dlst	A	T	12: 85,128,315	I260L	probably benign	Het
Dnajc13	T	G	9: 104,184,706	K1350Q	probably benign	Het
Dpp4	T	C	2: 62,354,599	Y520C	probably damaging	Het
Dr1	C	A	5: 108,275,728	A127E	unknown	Het
Dsel	C	T	1: 111,861,573	G411S	probably damaging	Het
E130308A19Rik	T	C	4: 59,752,770	C628R	probably damaging	Het
Edem3	T	A	1: 151,812,614		probably null	Het
Fam20a	T	A	11: 109,673,342	Q528H	possibly damaging	Het
Fanca	T	C	8: 123,281,213	E981G	probably benign	Het
Fbp2	A	G	13: 62,837,198	V303A	possibly damaging	Het
Flii	C	T	11: 60,721,119	V353M	possibly damaging	Het
Gm10277	T	A	11: 77,785,758	Y129F	unknown	Het
Gm3159	A	T	14: 4,398,525	H72L	probably benign	Het
Gm5114	T	G	7: 39,409,344	T284P	possibly damaging	Het
Gm7168	T	C	17: 13,949,885	S505P	probably damaging	Het
Gnal	T	C	18: 67,211,071	V239A	possibly damaging	Het
Gtf2i	C	T	5: 134,265,749	E370K	probably damaging	Het
Hivep3	CGG	CG	4: 120,097,911	1141	probably null	Het
Il3	T	A	11: 54,265,883	R93S	probably benign	Het
Itsn1	A	G	16: 91,908,450	E1573G	unknown	Het
Kif26a	G	A	12: 112,163,542		probably null	Het
Klb	T	C	5: 65,372,431	M434T	probably damaging	Het
Lrp2	T	A	2: 69,483,806	R2194W	probably damaging	Het
Lrp6	G	T	6: 134,450,818	P1604T	probably damaging	Het
Mak16	A	G	8: 31,166,099	Y119H	possibly damaging	Het
Map3k19	T	A	1: 127,817,455	M1421L	probably damaging	Het
Mbd5	A	G	2: 49,274,568	I1186V	probably benign	Het
Mboat1	T	A	13: 30,202,362	C120S	possibly damaging	Het
Mctp2	T	A	7: 72,259,214	D117V	probably benign	Het
Mocos	C	A	18: 24,676,616	N425K	probably damaging	Het
Nav2	A	G	7: 49,554,203		probably null	Het
Ngfr	A	T	11: 95,574,429	W198R	possibly damaging	Het
Nr4a3	T	G	4: 48,051,290	S15A	possibly damaging	Het
Obsl1	T	C	1: 75,502,964	S596G	probably damaging	Het
Olfr111	T	A	17: 37,530,817	V280D	probably damaging	Het
Olfr1414	A	G	1: 92,511,678	S117P	possibly damaging	Het
Olfr578	A	T	7: 102,984,516	I216K	probably damaging	Het
Olfr594	T	G	7: 103,220,533	Y272D	probably benign	Het
Olfr705	G	T	7: 106,873,396	P283Q	probably damaging	Het
Pithd1	T	C	4: 135,987,050	Y29C	probably benign	Het
Plcb3	T	C	19: 6,962,021	T530A	probably benign	Het
Prss40	A	T	1: 34,559,871	Y70*	probably null	Het
Ralgps1	T	C	2: 33,324,688	M61V	possibly damaging	Het
Rbp4	C	T	19: 38,124,962	R36H	possibly damaging	Het
Rnf125	A	G	18: 20,974,433	N7S	not run	Het
Rpe65	G	A	3: 159,624,729	S511N	probably benign	Het
Rspo4	A	T	2: 151,867,873	Y66F	probably damaging	Het
Ruvbl2	A	G	7: 45,422,149	S437P	probably benign	Het
Sele	C	A	1: 164,048,719	R12S	probably benign	Het
Sgo2b	T	A	8: 63,938,417	K139*	probably null	Het
Shroom3	C	A	5: 92,964,606	S1942*	probably null	Het
Slc12a9	G	A	5: 137,328,623	R191*	probably null	Het
Spag9	G	T	11: 94,108,521	V1088L	possibly damaging	Het
Sptb	T	G	12: 76,604,194	D1669A	probably damaging	Het
Sptlc2	A	G	12: 87,314,049		probably null	Het
Sult2a8	A	T	7: 14,416,329		probably null	Het
Synpo2	A	G	3: 123,114,041	V542A	probably damaging	Het
Tecpr2	T	C	12: 110,915,480		probably null	Het
Tenm2	T	C	11: 36,069,414	T1029A	probably benign	Het
Tgoln1	G	C	6: 72,616,278	T73R	probably benign	Het
Tnfaip8l1	C	A	17: 56,171,897	N62K	probably damaging	Het
Tollip	A	G	7: 141,889,597	S174P	probably benign	Het
Trp53tg5	A	G	2: 164,471,107	I216T	possibly damaging	Het
Tssk5	A	G	15: 76,374,513	S58P	probably benign	Het
Ttc9b	T	C	7: 27,654,959	Y157H	probably damaging	Het
Tuba8	A	G	6: 121,222,912	Y185C	probably damaging	Het
Ubr2	C	T	17: 46,955,845	A1127T	probably damaging	Het
Urb1	CACTTAC	CAC	16: 90,772,573		probably benign	Het
Yipf3	T	A	17: 46,248,929	L57Q	possibly damaging	Het
Zbtb32	A	C	7: 30,590,181	C19G	probably damaging	Het
Zfp735	A	T	11: 73,712,153	H641L	possibly damaging	Het
Zfyve28	A	T	5: 34,232,227	Y210N	probably damaging	Het
Zpr1	T	A	9: 46,273,373		probably null	Het

Other mutations in Abcb11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00544:Abcb11	APN	2	69284681	missense	possibly damaging	0.90
IGL01407:Abcb11	APN	2	69245944	missense	probably damaging	1.00
IGL01583:Abcb11	APN	2	69296409	missense	possibly damaging	0.81
IGL01813:Abcb11	APN	2	69287592	splice site	probably benign
IGL01885:Abcb11	APN	2	69287627	missense	probably damaging	1.00
IGL01937:Abcb11	APN	2	69287612	missense	probably damaging	1.00
IGL02058:Abcb11	APN	2	69243498	missense	probably damaging	0.98
IGL02117:Abcb11	APN	2	69323825	splice site	probably benign
IGL02119:Abcb11	APN	2	69328000	critical splice acceptor site	probably null
IGL02120:Abcb11	APN	2	69257310	missense	probably damaging	1.00
IGL02158:Abcb11	APN	2	69299925	missense	probably damaging	0.96
IGL02212:Abcb11	APN	2	69248889	missense	probably damaging	0.97
IGL02306:Abcb11	APN	2	69265457	nonsense	probably null
IGL02505:Abcb11	APN	2	69245761	missense	probably damaging	1.00
IGL02538:Abcb11	APN	2	69306605	missense	possibly damaging	0.67
IGL02793:Abcb11	APN	2	69291949	missense	possibly damaging	0.90
IGL02863:Abcb11	APN	2	69284682	missense	probably damaging	0.99
IGL02875:Abcb11	APN	2	69291949	missense	possibly damaging	0.90
IGL03164:Abcb11	APN	2	69291999	nonsense	probably null
IGL03181:Abcb11	APN	2	69328008	intron	probably benign
3-1:Abcb11	UTSW	2	69327993	missense	probably benign	0.00
FR4737:Abcb11	UTSW	2	69243518	missense	probably damaging	0.97
R0031:Abcb11	UTSW	2	69285308	missense	probably damaging	1.00
R0398:Abcb11	UTSW	2	69286666	missense	probably null	0.82
R0413:Abcb11	UTSW	2	69328011	intron	probably benign
R0437:Abcb11	UTSW	2	69257295	missense	probably damaging	1.00
R0496:Abcb11	UTSW	2	69277884	splice site	probably benign
R0646:Abcb11	UTSW	2	69285283	missense	probably damaging	1.00
R0669:Abcb11	UTSW	2	69329318	missense	probably benign	0.15
R0856:Abcb11	UTSW	2	69323918	missense	probably benign
R1061:Abcb11	UTSW	2	69277809	missense	probably benign	0.00
R1460:Abcb11	UTSW	2	69257374	splice site	probably benign
R1714:Abcb11	UTSW	2	69306581	missense	probably damaging	0.99
R1739:Abcb11	UTSW	2	69261566	missense	probably damaging	1.00
R1856:Abcb11	UTSW	2	69245923	missense	probably damaging	1.00
R1994:Abcb11	UTSW	2	69282670	splice site	probably null
R2086:Abcb11	UTSW	2	69259476	splice site	probably benign
R2133:Abcb11	UTSW	2	69323883	missense	possibly damaging	0.65
R2516:Abcb11	UTSW	2	69329329	missense	possibly damaging	0.88
R2930:Abcb11	UTSW	2	69257358	missense	probably damaging	0.96
R3771:Abcb11	UTSW	2	69329376	splice site	probably benign
R3772:Abcb11	UTSW	2	69329376	splice site	probably benign
R3979:Abcb11	UTSW	2	69323976	missense	probably benign	0.11
R4227:Abcb11	UTSW	2	69284776	missense	probably damaging	1.00
R4255:Abcb11	UTSW	2	69306605	missense	probably benign	0.03
R4614:Abcb11	UTSW	2	69284681	missense	possibly damaging	0.90
R4647:Abcb11	UTSW	2	69285271	missense	probably damaging	1.00
R4719:Abcb11	UTSW	2	69259627	missense	probably damaging	1.00
R4734:Abcb11	UTSW	2	69323962	missense	possibly damaging	0.73
R4765:Abcb11	UTSW	2	69245867	missense	probably damaging	1.00
R4861:Abcb11	UTSW	2	69245905	missense	probably damaging	1.00
R4861:Abcb11	UTSW	2	69245905	missense	probably damaging	1.00
R4870:Abcb11	UTSW	2	69239196	missense	probably damaging	0.99
R4988:Abcb11	UTSW	2	69323892	missense	probably benign	0.12
R5028:Abcb11	UTSW	2	69274012	missense	probably damaging	1.00
R5048:Abcb11	UTSW	2	69308506	missense	probably benign	0.06
R5177:Abcb11	UTSW	2	69285295	missense	probably damaging	1.00
R5301:Abcb11	UTSW	2	69286847	missense	probably damaging	0.98
R5789:Abcb11	UTSW	2	69245764	missense	probably damaging	1.00
R5892:Abcb11	UTSW	2	69261500	missense	probably damaging	0.99
R6003:Abcb11	UTSW	2	69243467	missense	probably benign	0.43
R6252:Abcb11	UTSW	2	69291961	missense	probably benign	0.10
R6389:Abcb11	UTSW	2	69323894	missense	probably damaging	1.00
R6512:Abcb11	UTSW	2	69282652	missense	probably benign
R6590:Abcb11	UTSW	2	69284718	missense	probably damaging	1.00
R6690:Abcb11	UTSW	2	69284718	missense	probably damaging	1.00
R6732:Abcb11	UTSW	2	69286846	missense	probably damaging	1.00
R6870:Abcb11	UTSW	2	69285298	missense	possibly damaging	0.91
R7028:Abcb11	UTSW	2	69265675	missense	probably benign
R7223:Abcb11	UTSW	2	69274143	missense	probably benign
R7323:Abcb11	UTSW	2	69287635	missense	probably damaging	1.00
R7337:Abcb11	UTSW	2	69245769	missense	probably damaging	1.00
R7339:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7340:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7341:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7343:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7393:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7394:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7405:Abcb11	UTSW	2	69287619	missense	probably damaging	1.00
R7411:Abcb11	UTSW	2	69303936	critical splice donor site	probably null
R7488:Abcb11	UTSW	2	69277802	missense	probably benign
R7544:Abcb11	UTSW	2	69265486	missense	probably benign	0.05
R7660:Abcb11	UTSW	2	69287594	splice site	probably null
R7754:Abcb11	UTSW	2	69286818	missense	probably damaging	1.00
R7771:Abcb11	UTSW	2	69239191	missense	probably damaging	0.99
R7794:Abcb11	UTSW	2	69286678	missense	possibly damaging	0.62
R7834:Abcb11	UTSW	2	69284724	missense	probably damaging	1.00
R7897:Abcb11	UTSW	2	69323872	frame shift	probably null
R7897:Abcb11	UTSW	2	69323873	small deletion	probably benign
R7937:Abcb11	UTSW	2	69323873	small deletion	probably benign
R8004:Abcb11	UTSW	2	69257210	missense	possibly damaging	0.68
R8089:Abcb11	UTSW	2	69274039	missense	probably benign	0.09
R8279:Abcb11	UTSW	2	69239205	missense	probably benign	0.05
R8426:Abcb11	UTSW	2	69325262	missense	probably benign
R8441:Abcb11	UTSW	2	69257230	missense	possibly damaging	0.93
R8460:Abcb11	UTSW	2	69324037	missense	possibly damaging	0.70
R8462:Abcb11	UTSW	2	69274155	missense	probably benign
R8532:Abcb11	UTSW	2	69259691	missense	possibly damaging	0.69
R8534:Abcb11	UTSW	2	69323846	missense	possibly damaging	0.89
R8711:Abcb11	UTSW	2	69265512	missense	probably damaging	1.00
R8746:Abcb11	UTSW	2	69257410	intron	probably benign
R8964:Abcb11	UTSW	2	69286717	missense	possibly damaging	0.52
R8990:Abcb11	UTSW	2	69274150	missense
R9081:Abcb11	UTSW	2	69292044	missense	possibly damaging	0.59
R9093:Abcb11	UTSW	2	69239169	missense	probably damaging	0.97
R9228:Abcb11	UTSW	2	69308465	nonsense	probably null
R9294:Abcb11	UTSW	2	69265496	missense	possibly damaging	0.89
X0058:Abcb11	UTSW	2	69289443	missense	probably benign	0.12
X0062:Abcb11	UTSW	2	69245906	missense	probably damaging	1.00
X0065:Abcb11	UTSW	2	69299866	missense	probably damaging	0.99
Z1176:Abcb11	UTSW	2	69291981	missense	probably damaging	1.00
Z1177:Abcb11	UTSW	2	69306529	missense	probably damaging	1.00
Z1177:Abcb11	UTSW	2	69329269	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGCCCATCAACATTTGCCAAT -3'
(R):5'- ACCCATCTTGAACCAGCTTT -3'

Sequencing Primer
(F):5'- CCTGTTGCTCTAAATGACAGTGGATC -3'
(R):5'- ACCCATCTTGAACCAGCTTTTTCTC -3'

Posted On

2019-09-13