Incidental Mutation 'R7366:Rpe65'
ID 571782
Institutional Source Beutler Lab
Gene Symbol Rpe65
Ensembl Gene ENSMUSG00000028174
Gene Name retinal pigment epithelium 65
Synonyms rd12, Mord1, A930029L06Rik
MMRRC Submission 045450-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.184) question?
Stock # R7366 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 159304812-159330958 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 159330366 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 511 (S511N)
Ref Sequence ENSEMBL: ENSMUSP00000029824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029824] [ENSMUST00000196999]
AlphaFold Q91ZQ5
Predicted Effect probably benign
Transcript: ENSMUST00000029824
AA Change: S511N

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000029824
Gene: ENSMUSG00000028174
AA Change: S511N

DomainStartEndE-ValueType
Pfam:RPE65 15 532 1.4e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196999
AA Change: S511N

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000143654
Gene: ENSMUSG00000028174
AA Change: S511N

DomainStartEndE-ValueType
Pfam:RPE65 15 532 1.4e-111 PFAM
Meta Mutation Damage Score 0.3951 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.1%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is located in the retinal pigment epithelium and is involved in the production of 11-cis retinal and in visual pigment regeneration. There are two forms of this protein, a soluble form called sRPE65, and a palmitoylated, membrane-bound form known as mRPE65. mRPE65 serves as the palmitoyl donor for lecithin retinol acyl transferase (LRAT), the enzyme that catalyzes the vitamin A to all trans retinol step of the chromophore regeneration process. Both mRPE65 and sRPE65 also serve as regulatory proteins, with the ratio and concentrations of these molecules playing a role in the inhibition of 11-cis retinal synthesis. Mutations in this gene have been associated with Leber congenital amaurosis type 2 (LCA2) and retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit disorganized outer segment discs, reduced rod function, lack of rhodopsin and lipofuscin flurophores, and over-accumulation of all-trans-retinyl esters in the retinal pigment epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik C T 8: 73,203,303 (GRCm39) P244S possibly damaging Het
4930562C15Rik A G 16: 4,653,633 (GRCm39) I61V unknown Het
Abcb11 C T 2: 69,130,211 (GRCm39) D282N probably damaging Het
Acbd3 A G 1: 180,562,064 (GRCm39) E181G probably benign Het
Ano3 T C 2: 110,587,412 (GRCm39) Y43C probably damaging Het
Aspa T A 11: 73,210,716 (GRCm39) probably null Het
AU018091 A T 7: 3,206,170 (GRCm39) N620K probably damaging Het
Bicc1 G T 10: 70,779,216 (GRCm39) T724K probably benign Het
Bmper T C 9: 23,395,300 (GRCm39) I677T probably damaging Het
C3 T A 17: 57,528,162 (GRCm39) T686S probably benign Het
Cc2d2a G T 5: 43,887,332 (GRCm39) R1315L probably damaging Het
Ccdc150 G T 1: 54,339,541 (GRCm39) E462* probably null Het
Ccdc88c C A 12: 100,911,209 (GRCm39) R875L possibly damaging Het
Cd177 C T 7: 24,456,147 (GRCm39) G207D probably damaging Het
Cdh23 A T 10: 60,151,471 (GRCm39) Y2471* probably null Het
Cep89 G A 7: 35,129,353 (GRCm39) R630H probably damaging Het
Cmbl A T 15: 31,590,002 (GRCm39) Y244F probably benign Het
Dcaf10 T C 4: 45,373,919 (GRCm39) V448A probably damaging Het
Ddr2 A G 1: 169,825,533 (GRCm39) W356R probably damaging Het
Depdc1a A G 3: 159,228,849 (GRCm39) I534V probably benign Het
Dhtkd1 T A 2: 5,922,717 (GRCm39) I481L probably benign Het
Dlst A T 12: 85,175,089 (GRCm39) I260L probably benign Het
Dnajc13 T G 9: 104,061,905 (GRCm39) K1350Q probably benign Het
Dpp4 T C 2: 62,184,943 (GRCm39) Y520C probably damaging Het
Dr1 C A 5: 108,423,594 (GRCm39) A127E unknown Het
Dsel C T 1: 111,789,303 (GRCm39) G411S probably damaging Het
E130308A19Rik T C 4: 59,752,770 (GRCm39) C628R probably damaging Het
Edem3 T A 1: 151,688,365 (GRCm39) probably null Het
Efcab15 T C 11: 103,098,944 (GRCm39) probably null Het
Fam20a T A 11: 109,564,168 (GRCm39) Q528H possibly damaging Het
Fanca T C 8: 124,007,952 (GRCm39) E981G probably benign Het
Fbp2 A G 13: 62,985,012 (GRCm39) V303A possibly damaging Het
Flii C T 11: 60,611,945 (GRCm39) V353M possibly damaging Het
Gm10277 T A 11: 77,676,584 (GRCm39) Y129F unknown Het
Gm3159 A T 14: 4,398,525 (GRCm38) H72L probably benign Het
Gm5114 T G 7: 39,058,768 (GRCm39) T284P possibly damaging Het
Gm7168 T C 17: 14,170,147 (GRCm39) S505P probably damaging Het
Gnal T C 18: 67,344,142 (GRCm39) V239A possibly damaging Het
Gtf2i C T 5: 134,294,603 (GRCm39) E370K probably damaging Het
Hivep3 CGG CG 4: 119,955,108 (GRCm39) 1141 probably null Het
Il3 T A 11: 54,156,709 (GRCm39) R93S probably benign Het
Itsn1 A G 16: 91,705,338 (GRCm39) E1573G unknown Het
Kif26a G A 12: 112,129,976 (GRCm39) probably null Het
Klb T C 5: 65,529,774 (GRCm39) M434T probably damaging Het
Lrp2 T A 2: 69,314,150 (GRCm39) R2194W probably damaging Het
Lrp6 G T 6: 134,427,781 (GRCm39) P1604T probably damaging Het
Mak16 A G 8: 31,656,127 (GRCm39) Y119H possibly damaging Het
Map3k19 T A 1: 127,745,192 (GRCm39) M1421L probably damaging Het
Mbd5 A G 2: 49,164,580 (GRCm39) I1186V probably benign Het
Mboat1 T A 13: 30,386,345 (GRCm39) C120S possibly damaging Het
Mctp2 T A 7: 71,908,962 (GRCm39) D117V probably benign Het
Mocos C A 18: 24,809,673 (GRCm39) N425K probably damaging Het
Nav2 A G 7: 49,203,951 (GRCm39) probably null Het
Ngfr A T 11: 95,465,255 (GRCm39) W198R possibly damaging Het
Nr4a3 T G 4: 48,051,290 (GRCm39) S15A possibly damaging Het
Obsl1 T C 1: 75,479,608 (GRCm39) S596G probably damaging Het
Or2ag1 G T 7: 106,472,603 (GRCm39) P283Q probably damaging Het
Or51g1 A T 7: 102,633,723 (GRCm39) I216K probably damaging Het
Or52e3 T G 7: 102,869,740 (GRCm39) Y272D probably benign Het
Or5v1b T A 17: 37,841,708 (GRCm39) V280D probably damaging Het
Or6b3 A G 1: 92,439,400 (GRCm39) S117P possibly damaging Het
Pithd1 T C 4: 135,714,361 (GRCm39) Y29C probably benign Het
Plcb3 T C 19: 6,939,389 (GRCm39) T530A probably benign Het
Prss40 A T 1: 34,598,952 (GRCm39) Y70* probably null Het
Ralgps1 T C 2: 33,214,700 (GRCm39) M61V possibly damaging Het
Rbp4 C T 19: 38,113,410 (GRCm39) R36H possibly damaging Het
Rnf125 A G 18: 21,107,490 (GRCm39) N7S not run Het
Rspo4 A T 2: 151,709,793 (GRCm39) Y66F probably damaging Het
Ruvbl2 A G 7: 45,071,573 (GRCm39) S437P probably benign Het
Sele C A 1: 163,876,288 (GRCm39) R12S probably benign Het
Sgo2b T A 8: 64,391,451 (GRCm39) K139* probably null Het
Shroom3 C A 5: 93,112,465 (GRCm39) S1942* probably null Het
Slc12a9 G A 5: 137,326,885 (GRCm39) R191* probably null Het
Spag9 G T 11: 93,999,347 (GRCm39) V1088L possibly damaging Het
Sptb T G 12: 76,650,968 (GRCm39) D1669A probably damaging Het
Sptlc2 A G 12: 87,360,823 (GRCm39) probably null Het
Sult2a8 A T 7: 14,150,254 (GRCm39) probably null Het
Synpo2 A G 3: 122,907,690 (GRCm39) V542A probably damaging Het
Tecpr2 T C 12: 110,881,914 (GRCm39) probably null Het
Tektip1 T C 10: 81,200,025 (GRCm39) D165G possibly damaging Het
Tenm2 T C 11: 35,960,241 (GRCm39) T1029A probably benign Het
Tgoln1 G C 6: 72,593,261 (GRCm39) T73R probably benign Het
Tnfaip8l1 C A 17: 56,478,897 (GRCm39) N62K probably damaging Het
Tollip A G 7: 141,443,334 (GRCm39) S174P probably benign Het
Trp53tg5 A G 2: 164,313,027 (GRCm39) I216T possibly damaging Het
Tssk5 A G 15: 76,258,713 (GRCm39) S58P probably benign Het
Ttc9b T C 7: 27,354,384 (GRCm39) Y157H probably damaging Het
Tuba8 A G 6: 121,199,871 (GRCm39) Y185C probably damaging Het
Ubr2 C T 17: 47,266,771 (GRCm39) A1127T probably damaging Het
Urb1 CACTTAC CAC 16: 90,569,461 (GRCm39) probably benign Het
Yipf3 T A 17: 46,559,855 (GRCm39) L57Q possibly damaging Het
Zbtb32 A C 7: 30,289,606 (GRCm39) C19G probably damaging Het
Zfp735 A T 11: 73,602,979 (GRCm39) H641L possibly damaging Het
Zfyve28 A T 5: 34,389,571 (GRCm39) Y210N probably damaging Het
Zpr1 T A 9: 46,184,671 (GRCm39) probably null Het
Other mutations in Rpe65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Rpe65 APN 3 159,320,179 (GRCm39) missense probably damaging 0.99
IGL01446:Rpe65 APN 3 159,306,042 (GRCm39) splice site probably benign
IGL01815:Rpe65 APN 3 159,310,167 (GRCm39) splice site probably null
IGL02085:Rpe65 APN 3 159,321,283 (GRCm39) missense probably benign 0.00
IGL02232:Rpe65 APN 3 159,309,988 (GRCm39) missense possibly damaging 0.93
IGL02248:Rpe65 APN 3 159,330,342 (GRCm39) missense probably damaging 1.00
IGL02645:Rpe65 APN 3 159,312,128 (GRCm39) missense probably damaging 0.99
IGL02711:Rpe65 APN 3 159,328,514 (GRCm39) missense possibly damaging 0.84
IGL02982:Rpe65 APN 3 159,305,998 (GRCm39) missense probably damaging 0.99
IGL03280:Rpe65 APN 3 159,309,978 (GRCm39) missense probably damaging 0.96
IGL03350:Rpe65 APN 3 159,320,154 (GRCm39) missense possibly damaging 0.75
IGL03356:Rpe65 APN 3 159,321,214 (GRCm39) missense possibly damaging 0.89
I1329:Rpe65 UTSW 3 159,330,360 (GRCm39) missense probably benign 0.35
R0571:Rpe65 UTSW 3 159,305,986 (GRCm39) missense probably damaging 1.00
R0905:Rpe65 UTSW 3 159,307,220 (GRCm39) missense possibly damaging 0.95
R1024:Rpe65 UTSW 3 159,312,122 (GRCm39) missense probably benign 0.07
R1597:Rpe65 UTSW 3 159,320,421 (GRCm39) missense probably damaging 0.97
R1657:Rpe65 UTSW 3 159,320,085 (GRCm39) missense probably damaging 0.97
R1778:Rpe65 UTSW 3 159,328,485 (GRCm39) missense probably damaging 1.00
R1970:Rpe65 UTSW 3 159,321,307 (GRCm39) missense probably benign
R2259:Rpe65 UTSW 3 159,321,208 (GRCm39) missense probably damaging 1.00
R3012:Rpe65 UTSW 3 159,310,200 (GRCm39) missense possibly damaging 0.61
R3923:Rpe65 UTSW 3 159,310,037 (GRCm39) missense probably benign 0.16
R3975:Rpe65 UTSW 3 159,310,222 (GRCm39) missense probably damaging 1.00
R4204:Rpe65 UTSW 3 159,310,047 (GRCm39) missense probably damaging 0.99
R4825:Rpe65 UTSW 3 159,330,318 (GRCm39) missense probably benign
R4924:Rpe65 UTSW 3 159,328,268 (GRCm39) missense probably benign 0.01
R5269:Rpe65 UTSW 3 159,309,984 (GRCm39) missense probably benign 0.07
R5324:Rpe65 UTSW 3 159,310,041 (GRCm39) missense possibly damaging 0.94
R5441:Rpe65 UTSW 3 159,310,038 (GRCm39) missense probably damaging 1.00
R5854:Rpe65 UTSW 3 159,321,313 (GRCm39) missense probably benign
R5907:Rpe65 UTSW 3 159,321,319 (GRCm39) critical splice donor site probably null
R6149:Rpe65 UTSW 3 159,319,780 (GRCm39) missense probably benign
R6660:Rpe65 UTSW 3 159,320,345 (GRCm39) missense probably damaging 0.98
R6830:Rpe65 UTSW 3 159,319,805 (GRCm39) missense probably benign 0.06
R7025:Rpe65 UTSW 3 159,328,322 (GRCm39) missense probably damaging 1.00
R7092:Rpe65 UTSW 3 159,321,228 (GRCm39) missense probably damaging 1.00
R7203:Rpe65 UTSW 3 159,328,491 (GRCm39) missense probably damaging 0.99
R7537:Rpe65 UTSW 3 159,310,246 (GRCm39) missense probably damaging 0.98
R7679:Rpe65 UTSW 3 159,310,030 (GRCm39) missense probably damaging 1.00
R8044:Rpe65 UTSW 3 159,320,342 (GRCm39) missense probably benign
R8179:Rpe65 UTSW 3 159,330,336 (GRCm39) missense probably benign 0.06
R8409:Rpe65 UTSW 3 159,319,785 (GRCm39) missense probably benign 0.01
R8558:Rpe65 UTSW 3 159,320,429 (GRCm39) missense probably damaging 1.00
R9042:Rpe65 UTSW 3 159,321,292 (GRCm39) missense probably damaging 1.00
R9483:Rpe65 UTSW 3 159,328,318 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTATTCCTTCAAGTGGTCACACAG -3'
(R):5'- TGCCATTAGAAACATGTCTTGCTAG -3'

Sequencing Primer
(F):5'- TGAATCCCAGCACTTTGGAG -3'
(R):5'- GACAACTTCCAGGAGTAAGTTCTGTC -3'
Posted On 2019-09-13