Mutagenetix > Incidental Mutation

Incidental Mutation 'R7366:Rpe65'

571782

Institutional Source

Beutler Lab

Gene Symbol

Rpe65

Ensembl Gene

ENSMUSG00000028174

Gene Name

retinal pigment epithelium 65

Synonyms

A930029L06Rik, Mord1, rd12

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.243) question?

Stock #

R7366 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

159599175-159625321 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 159624729 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 511 (S511N)

Ref Sequence

ENSEMBL: ENSMUSP00000029824 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029824] [ENSMUST00000196999]

AlphaFold

Q91ZQ5

Predicted Effect

probably benign
Transcript: ENSMUST00000029824
AA Change: S511N

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000029824
Gene: ENSMUSG00000028174
AA Change: S511N

Domain	Start	End	E-Value	Type
Pfam:RPE65	15	532	1.4e-111	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000196999
AA Change: S511N

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000143654
Gene: ENSMUSG00000028174
AA Change: S511N

Domain	Start	End	E-Value	Type
Pfam:RPE65	15	532	1.4e-111	PFAM

Meta Mutation Damage Score

0.3951

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.1%

Validation Efficiency

99% (94/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is located in the retinal pigment epithelium and is involved in the production of 11-cis retinal and in visual pigment regeneration. There are two forms of this protein, a soluble form called sRPE65, and a palmitoylated, membrane-bound form known as mRPE65. mRPE65 serves as the palmitoyl donor for lecithin retinol acyl transferase (LRAT), the enzyme that catalyzes the vitamin A to all trans retinol step of the chromophore regeneration process. Both mRPE65 and sRPE65 also serve as regulatory proteins, with the ratio and concentrations of these molecules playing a role in the inhibition of 11-cis retinal synthesis. Mutations in this gene have been associated with Leber congenital amaurosis type 2 (LCA2) and retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit disorganized outer segment discs, reduced rod function, lack of rhodopsin and lipofuscin flurophores, and over-accumulation of all-trans-retinyl esters in the retinal pigment epithelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700023F06Rik	T	C	11: 103,208,118		probably null	Het
1700030K09Rik	C	T	8: 72,449,459	P244S	possibly damaging	Het
4930404N11Rik	T	C	10: 81,364,191	D165G	possibly damaging	Het
4930562C15Rik	A	G	16: 4,835,769	I61V	unknown	Het
Abcb11	C	T	2: 69,299,867	D282N	probably damaging	Het
Acbd3	A	G	1: 180,734,499	E181G	probably benign	Het
Ano3	T	C	2: 110,757,067	Y43C	probably damaging	Het
Aspa	T	A	11: 73,319,890		probably null	Het
AU018091	A	T	7: 3,156,330	N620K	probably damaging	Het
Bicc1	G	T	10: 70,943,386	T724K	probably benign	Het
Bmper	T	C	9: 23,484,004	I677T	probably damaging	Het
C3	T	A	17: 57,221,162	T686S	probably benign	Het
Cc2d2a	G	T	5: 43,729,990	R1315L	probably damaging	Het
Ccdc150	G	T	1: 54,300,382	E462*	probably null	Het
Ccdc88c	C	A	12: 100,944,950	R875L	possibly damaging	Het
Cd177	C	T	7: 24,756,722	G207D	probably damaging	Het
Cdh23	A	T	10: 60,315,692	Y2471*	probably null	Het
Cep89	G	A	7: 35,429,928	R630H	probably damaging	Het
Cmbl	A	T	15: 31,589,856	Y244F	probably benign	Het
Dcaf10	T	C	4: 45,373,919	V448A	probably damaging	Het
Ddr2	A	G	1: 169,997,964	W356R	probably damaging	Het
Depdc1a	A	G	3: 159,523,212	I534V	probably benign	Het
Dhtkd1	T	A	2: 5,917,906	I481L	probably benign	Het
Dlst	A	T	12: 85,128,315	I260L	probably benign	Het
Dnajc13	T	G	9: 104,184,706	K1350Q	probably benign	Het
Dpp4	T	C	2: 62,354,599	Y520C	probably damaging	Het
Dr1	C	A	5: 108,275,728	A127E	unknown	Het
Dsel	C	T	1: 111,861,573	G411S	probably damaging	Het
E130308A19Rik	T	C	4: 59,752,770	C628R	probably damaging	Het
Edem3	T	A	1: 151,812,614		probably null	Het
Fam20a	T	A	11: 109,673,342	Q528H	possibly damaging	Het
Fanca	T	C	8: 123,281,213	E981G	probably benign	Het
Fbp2	A	G	13: 62,837,198	V303A	possibly damaging	Het
Flii	C	T	11: 60,721,119	V353M	possibly damaging	Het
Gm10277	T	A	11: 77,785,758	Y129F	unknown	Het
Gm3159	A	T	14: 4,398,525	H72L	probably benign	Het
Gm5114	T	G	7: 39,409,344	T284P	possibly damaging	Het
Gm7168	T	C	17: 13,949,885	S505P	probably damaging	Het
Gnal	T	C	18: 67,211,071	V239A	possibly damaging	Het
Gtf2i	C	T	5: 134,265,749	E370K	probably damaging	Het
Hivep3	CGG	CG	4: 120,097,911	1141	probably null	Het
Il3	T	A	11: 54,265,883	R93S	probably benign	Het
Itsn1	A	G	16: 91,908,450	E1573G	unknown	Het
Kif26a	G	A	12: 112,163,542		probably null	Het
Klb	T	C	5: 65,372,431	M434T	probably damaging	Het
Lrp2	T	A	2: 69,483,806	R2194W	probably damaging	Het
Lrp6	G	T	6: 134,450,818	P1604T	probably damaging	Het
Mak16	A	G	8: 31,166,099	Y119H	possibly damaging	Het
Map3k19	T	A	1: 127,817,455	M1421L	probably damaging	Het
Mbd5	A	G	2: 49,274,568	I1186V	probably benign	Het
Mboat1	T	A	13: 30,202,362	C120S	possibly damaging	Het
Mctp2	T	A	7: 72,259,214	D117V	probably benign	Het
Mocos	C	A	18: 24,676,616	N425K	probably damaging	Het
Nav2	A	G	7: 49,554,203		probably null	Het
Ngfr	A	T	11: 95,574,429	W198R	possibly damaging	Het
Nr4a3	T	G	4: 48,051,290	S15A	possibly damaging	Het
Obsl1	T	C	1: 75,502,964	S596G	probably damaging	Het
Olfr111	T	A	17: 37,530,817	V280D	probably damaging	Het
Olfr1414	A	G	1: 92,511,678	S117P	possibly damaging	Het
Olfr578	A	T	7: 102,984,516	I216K	probably damaging	Het
Olfr594	T	G	7: 103,220,533	Y272D	probably benign	Het
Olfr705	G	T	7: 106,873,396	P283Q	probably damaging	Het
Pithd1	T	C	4: 135,987,050	Y29C	probably benign	Het
Plcb3	T	C	19: 6,962,021	T530A	probably benign	Het
Prss40	A	T	1: 34,559,871	Y70*	probably null	Het
Ralgps1	T	C	2: 33,324,688	M61V	possibly damaging	Het
Rbp4	C	T	19: 38,124,962	R36H	possibly damaging	Het
Rnf125	A	G	18: 20,974,433	N7S	not run	Het
Rspo4	A	T	2: 151,867,873	Y66F	probably damaging	Het
Ruvbl2	A	G	7: 45,422,149	S437P	probably benign	Het
Sele	C	A	1: 164,048,719	R12S	probably benign	Het
Sgo2b	T	A	8: 63,938,417	K139*	probably null	Het
Shroom3	C	A	5: 92,964,606	S1942*	probably null	Het
Slc12a9	G	A	5: 137,328,623	R191*	probably null	Het
Spag9	G	T	11: 94,108,521	V1088L	possibly damaging	Het
Sptb	T	G	12: 76,604,194	D1669A	probably damaging	Het
Sptlc2	A	G	12: 87,314,049		probably null	Het
Sult2a8	A	T	7: 14,416,329		probably null	Het
Synpo2	A	G	3: 123,114,041	V542A	probably damaging	Het
Tecpr2	T	C	12: 110,915,480		probably null	Het
Tenm2	T	C	11: 36,069,414	T1029A	probably benign	Het
Tgoln1	G	C	6: 72,616,278	T73R	probably benign	Het
Tnfaip8l1	C	A	17: 56,171,897	N62K	probably damaging	Het
Tollip	A	G	7: 141,889,597	S174P	probably benign	Het
Trp53tg5	A	G	2: 164,471,107	I216T	possibly damaging	Het
Tssk5	A	G	15: 76,374,513	S58P	probably benign	Het
Ttc9b	T	C	7: 27,654,959	Y157H	probably damaging	Het
Tuba8	A	G	6: 121,222,912	Y185C	probably damaging	Het
Ubr2	C	T	17: 46,955,845	A1127T	probably damaging	Het
Urb1	CACTTAC	CAC	16: 90,772,573		probably benign	Het
Yipf3	T	A	17: 46,248,929	L57Q	possibly damaging	Het
Zbtb32	A	C	7: 30,590,181	C19G	probably damaging	Het
Zfp735	A	T	11: 73,712,153	H641L	possibly damaging	Het
Zfyve28	A	T	5: 34,232,227	Y210N	probably damaging	Het
Zpr1	T	A	9: 46,273,373		probably null	Het

Other mutations in Rpe65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Rpe65	APN	3	159614542	missense	probably damaging	0.99
IGL01446:Rpe65	APN	3	159600405	splice site	probably benign
IGL01815:Rpe65	APN	3	159604530	splice site	probably null
IGL02085:Rpe65	APN	3	159615646	missense	probably benign	0.00
IGL02232:Rpe65	APN	3	159604351	missense	possibly damaging	0.93
IGL02248:Rpe65	APN	3	159624705	missense	probably damaging	1.00
IGL02645:Rpe65	APN	3	159606491	missense	probably damaging	0.99
IGL02711:Rpe65	APN	3	159622877	missense	possibly damaging	0.84
IGL02982:Rpe65	APN	3	159600361	missense	probably damaging	0.99
IGL03280:Rpe65	APN	3	159604341	missense	probably damaging	0.96
IGL03350:Rpe65	APN	3	159614517	missense	possibly damaging	0.75
IGL03356:Rpe65	APN	3	159615577	missense	possibly damaging	0.89
I1329:Rpe65	UTSW	3	159624723	missense	probably benign	0.35
R0571:Rpe65	UTSW	3	159600349	missense	probably damaging	1.00
R0905:Rpe65	UTSW	3	159601583	missense	possibly damaging	0.95
R1024:Rpe65	UTSW	3	159606485	missense	probably benign	0.07
R1597:Rpe65	UTSW	3	159614784	missense	probably damaging	0.97
R1657:Rpe65	UTSW	3	159614448	missense	probably damaging	0.97
R1778:Rpe65	UTSW	3	159622848	missense	probably damaging	1.00
R1970:Rpe65	UTSW	3	159615670	missense	probably benign
R2259:Rpe65	UTSW	3	159615571	missense	probably damaging	1.00
R3012:Rpe65	UTSW	3	159604563	missense	possibly damaging	0.61
R3923:Rpe65	UTSW	3	159604400	missense	probably benign	0.16
R3975:Rpe65	UTSW	3	159604585	missense	probably damaging	1.00
R4204:Rpe65	UTSW	3	159604410	missense	probably damaging	0.99
R4825:Rpe65	UTSW	3	159624681	missense	probably benign
R4924:Rpe65	UTSW	3	159622631	missense	probably benign	0.01
R5269:Rpe65	UTSW	3	159604347	missense	probably benign	0.07
R5324:Rpe65	UTSW	3	159604404	missense	possibly damaging	0.94
R5441:Rpe65	UTSW	3	159604401	missense	probably damaging	1.00
R5854:Rpe65	UTSW	3	159615676	missense	probably benign
R5907:Rpe65	UTSW	3	159615682	critical splice donor site	probably null
R6149:Rpe65	UTSW	3	159614143	missense	probably benign
R6660:Rpe65	UTSW	3	159614708	missense	probably damaging	0.98
R6830:Rpe65	UTSW	3	159614168	missense	probably benign	0.06
R7025:Rpe65	UTSW	3	159622685	missense	probably damaging	1.00
R7092:Rpe65	UTSW	3	159615591	missense	probably damaging	1.00
R7203:Rpe65	UTSW	3	159622854	missense	probably damaging	0.99
R7537:Rpe65	UTSW	3	159604609	missense	probably damaging	0.98
R7679:Rpe65	UTSW	3	159604393	missense	probably damaging	1.00
R8044:Rpe65	UTSW	3	159614705	missense	probably benign
R8179:Rpe65	UTSW	3	159624699	missense	probably benign	0.06
R8409:Rpe65	UTSW	3	159614148	missense	probably benign	0.01
R8558:Rpe65	UTSW	3	159614792	missense	probably damaging	1.00
R9042:Rpe65	UTSW	3	159615655	missense	probably damaging	1.00
R9483:Rpe65	UTSW	3	159622681	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAGTATTCCTTCAAGTGGTCACACAG -3'
(R):5'- TGCCATTAGAAACATGTCTTGCTAG -3'

Sequencing Primer
(F):5'- TGAATCCCAGCACTTTGGAG -3'
(R):5'- GACAACTTCCAGGAGTAAGTTCTGTC -3'

Posted On

2019-09-13