Incidental Mutation 'R7366:Dnajc13'
ID571812
Institutional Source Beutler Lab
Gene Symbol Dnajc13
Ensembl Gene ENSMUSG00000032560
Gene NameDnaJ heat shock protein family (Hsp40) member C13
SynonymsLOC382100, D030002L11Rik, Rme8
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R7366 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location104151282-104262930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 104184706 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 1350 (K1350Q)
Ref Sequence ENSEMBL: ENSMUSP00000139804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035170] [ENSMUST00000186788]
Predicted Effect probably benign
Transcript: ENSMUST00000035170
AA Change: K1345Q

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000035170
Gene: ENSMUSG00000032560
AA Change: K1345Q

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
Blast:ARM 927 963 6e-12 BLAST
Pfam:DUF4339 976 1020 1.5e-18 PFAM
Blast:ARM 1071 1110 5e-12 BLAST
DnaJ 1300 1358 5.69e-18 SMART
low complexity region 1417 1426 N/A INTRINSIC
low complexity region 1813 1829 N/A INTRINSIC
Blast:ARM 1843 1884 6e-8 BLAST
low complexity region 1968 1984 N/A INTRINSIC
low complexity region 2006 2016 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185503
Predicted Effect probably benign
Transcript: ENSMUST00000186788
AA Change: K1350Q

PolyPhen 2 Score 0.426 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139804
Gene: ENSMUSG00000032560
AA Change: K1350Q

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 837 848 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
Blast:ARM 932 968 6e-12 BLAST
Pfam:DUF4339 980 1025 8.1e-14 PFAM
Blast:ARM 1076 1115 5e-12 BLAST
DnaJ 1305 1363 5.69e-18 SMART
low complexity region 1422 1431 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
Blast:ARM 1848 1889 6e-8 BLAST
low complexity region 1973 1989 N/A INTRINSIC
low complexity region 2011 2021 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.1%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson's disease. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,208,118 probably null Het
1700030K09Rik C T 8: 72,449,459 P244S possibly damaging Het
4930404N11Rik T C 10: 81,364,191 D165G possibly damaging Het
4930562C15Rik A G 16: 4,835,769 I61V unknown Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Acbd3 A G 1: 180,734,499 E181G probably benign Het
Ano3 T C 2: 110,757,067 Y43C probably damaging Het
Aspa T A 11: 73,319,890 probably null Het
AU018091 A T 7: 3,156,330 N620K probably damaging Het
Bicc1 G T 10: 70,943,386 T724K probably benign Het
Bmper T C 9: 23,484,004 I677T probably damaging Het
C3 T A 17: 57,221,162 T686S probably benign Het
Cc2d2a G T 5: 43,729,990 R1315L probably damaging Het
Ccdc150 G T 1: 54,300,382 E462* probably null Het
Ccdc88c C A 12: 100,944,950 R875L possibly damaging Het
Cd177 C T 7: 24,756,722 G207D probably damaging Het
Cdh23 A T 10: 60,315,692 Y2471* probably null Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cmbl A T 15: 31,589,856 Y244F probably benign Het
Dcaf10 T C 4: 45,373,919 V448A probably damaging Het
Ddr2 A G 1: 169,997,964 W356R probably damaging Het
Depdc1a A G 3: 159,523,212 I534V probably benign Het
Dhtkd1 T A 2: 5,917,906 I481L probably benign Het
Dlst A T 12: 85,128,315 I260L probably benign Het
Dpp4 T C 2: 62,354,599 Y520C probably damaging Het
Dr1 C A 5: 108,275,728 A127E unknown Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
E130308A19Rik T C 4: 59,752,770 C628R probably damaging Het
Edem3 T A 1: 151,812,614 probably null Het
Fam20a T A 11: 109,673,342 Q528H possibly damaging Het
Fanca T C 8: 123,281,213 E981G probably benign Het
Fbp2 A G 13: 62,837,198 V303A possibly damaging Het
Flii C T 11: 60,721,119 V353M possibly damaging Het
Gm10277 T A 11: 77,785,758 Y129F unknown Het
Gm3159 A T 14: 4,398,525 H72L probably benign Het
Gm5114 T G 7: 39,409,344 T284P possibly damaging Het
Gm7168 T C 17: 13,949,885 S505P probably damaging Het
Gnal T C 18: 67,211,071 V239A possibly damaging Het
Gtf2i C T 5: 134,265,749 E370K probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Il3 T A 11: 54,265,883 R93S probably benign Het
Itsn1 A G 16: 91,908,450 E1573G unknown Het
Kif26a G A 12: 112,163,542 probably null Het
Klb T C 5: 65,372,431 M434T probably damaging Het
Lrp2 T A 2: 69,483,806 R2194W probably damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Mak16 A G 8: 31,166,099 Y119H possibly damaging Het
Map3k19 T A 1: 127,817,455 M1421L probably damaging Het
Mbd5 A G 2: 49,274,568 I1186V probably benign Het
Mboat1 T A 13: 30,202,362 C120S possibly damaging Het
Mctp2 T A 7: 72,259,214 D117V probably benign Het
Mocos C A 18: 24,676,616 N425K probably damaging Het
Nav2 A G 7: 49,554,203 probably null Het
Ngfr A T 11: 95,574,429 W198R possibly damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Obsl1 T C 1: 75,502,964 S596G probably damaging Het
Olfr111 T A 17: 37,530,817 V280D probably damaging Het
Olfr1414 A G 1: 92,511,678 S117P possibly damaging Het
Olfr578 A T 7: 102,984,516 I216K probably damaging Het
Olfr594 T G 7: 103,220,533 Y272D probably benign Het
Olfr705 G T 7: 106,873,396 P283Q probably damaging Het
Pithd1 T C 4: 135,987,050 Y29C probably benign Het
Plcb3 T C 19: 6,962,021 T530A probably benign Het
Prss40 A T 1: 34,559,871 Y70* probably null Het
Ralgps1 T C 2: 33,324,688 M61V possibly damaging Het
Rbp4 C T 19: 38,124,962 R36H possibly damaging Het
Rnf125 A G 18: 20,974,433 N7S not run Het
Rpe65 G A 3: 159,624,729 S511N probably benign Het
Rspo4 A T 2: 151,867,873 Y66F probably damaging Het
Ruvbl2 A G 7: 45,422,149 S437P probably benign Het
Sele C A 1: 164,048,719 R12S probably benign Het
Sgo2b T A 8: 63,938,417 K139* probably null Het
Shroom3 C A 5: 92,964,606 S1942* probably null Het
Slc12a9 G A 5: 137,328,623 R191* probably null Het
Spag9 G T 11: 94,108,521 V1088L possibly damaging Het
Sptb T G 12: 76,604,194 D1669A probably damaging Het
Sptlc2 A G 12: 87,314,049 probably null Het
Sult2a8 A T 7: 14,416,329 probably null Het
Synpo2 A G 3: 123,114,041 V542A probably damaging Het
Tecpr2 T C 12: 110,915,480 probably null Het
Tenm2 T C 11: 36,069,414 T1029A probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tnfaip8l1 C A 17: 56,171,897 N62K probably damaging Het
Tollip A G 7: 141,889,597 S174P probably benign Het
Trp53tg5 A G 2: 164,471,107 I216T possibly damaging Het
Tssk5 A G 15: 76,374,513 S58P probably benign Het
Ttc9b T C 7: 27,654,959 Y157H probably damaging Het
Tuba8 A G 6: 121,222,912 Y185C probably damaging Het
Ubr2 C T 17: 46,955,845 A1127T probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Yipf3 T A 17: 46,248,929 L57Q possibly damaging Het
Zbtb32 A C 7: 30,590,181 C19G probably damaging Het
Zfp735 A T 11: 73,712,153 H641L possibly damaging Het
Zfyve28 A T 5: 34,232,227 Y210N probably damaging Het
Zpr1 T A 9: 46,273,373 probably null Het
Other mutations in Dnajc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Dnajc13 APN 9 104162780 missense probably benign 0.15
IGL00754:Dnajc13 APN 9 104174498 nonsense probably null
IGL00914:Dnajc13 APN 9 104212882 missense possibly damaging 0.90
IGL01014:Dnajc13 APN 9 104203218 missense probably damaging 1.00
IGL01077:Dnajc13 APN 9 104231021 missense probably benign 0.11
IGL01137:Dnajc13 APN 9 104160490 missense probably benign
IGL01305:Dnajc13 APN 9 104230637 splice site probably null
IGL01707:Dnajc13 APN 9 104228979 missense probably damaging 1.00
IGL01781:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL01868:Dnajc13 APN 9 104162745 missense possibly damaging 0.83
IGL01950:Dnajc13 APN 9 104190432 missense possibly damaging 0.85
IGL02102:Dnajc13 APN 9 104229009 missense possibly damaging 0.78
IGL02350:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02357:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02470:Dnajc13 APN 9 104175747 missense probably benign 0.17
IGL02888:Dnajc13 APN 9 104180062 splice site probably benign
IGL03079:Dnajc13 APN 9 104212869 nonsense probably null
IGL03179:Dnajc13 APN 9 104167435 missense probably benign 0.42
IGL03293:Dnajc13 APN 9 104174426 missense possibly damaging 0.64
PIT4142001:Dnajc13 UTSW 9 104238473 missense probably damaging 0.96
R0323:Dnajc13 UTSW 9 104156892 missense probably damaging 1.00
R0361:Dnajc13 UTSW 9 104167059 missense probably benign 0.18
R0480:Dnajc13 UTSW 9 104200509 missense probably damaging 0.98
R0558:Dnajc13 UTSW 9 104201952 critical splice acceptor site probably null
R0707:Dnajc13 UTSW 9 104172582 missense probably benign 0.12
R0831:Dnajc13 UTSW 9 104172612 missense probably damaging 1.00
R1234:Dnajc13 UTSW 9 104214157 missense possibly damaging 0.64
R1433:Dnajc13 UTSW 9 104180121 missense probably damaging 1.00
R1463:Dnajc13 UTSW 9 104178940 missense probably damaging 1.00
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1489:Dnajc13 UTSW 9 104231035 missense possibly damaging 0.94
R1575:Dnajc13 UTSW 9 104156838 missense probably benign 0.29
R1750:Dnajc13 UTSW 9 104221477 missense probably damaging 0.98
R1903:Dnajc13 UTSW 9 104228937 missense probably damaging 0.98
R2066:Dnajc13 UTSW 9 104221441 missense probably benign 0.01
R2206:Dnajc13 UTSW 9 104203518 missense probably damaging 1.00
R3160:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R3162:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R4158:Dnajc13 UTSW 9 104190442 missense probably damaging 0.96
R4460:Dnajc13 UTSW 9 104181063 missense probably damaging 0.96
R4537:Dnajc13 UTSW 9 104186805 intron probably benign
R4538:Dnajc13 UTSW 9 104186805 intron probably benign
R4631:Dnajc13 UTSW 9 104190417 missense probably damaging 1.00
R4662:Dnajc13 UTSW 9 104207758 missense probably damaging 1.00
R4722:Dnajc13 UTSW 9 104213818 missense probably benign
R4731:Dnajc13 UTSW 9 104186805 intron probably benign
R4732:Dnajc13 UTSW 9 104186805 intron probably benign
R4758:Dnajc13 UTSW 9 104172574 missense probably damaging 1.00
R4801:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4802:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4928:Dnajc13 UTSW 9 104233638 missense possibly damaging 0.93
R4944:Dnajc13 UTSW 9 104167387 unclassified probably benign
R4979:Dnajc13 UTSW 9 104186723 missense probably damaging 1.00
R5177:Dnajc13 UTSW 9 104230986 missense probably benign 0.39
R5190:Dnajc13 UTSW 9 104174525 missense probably benign 0.00
R5256:Dnajc13 UTSW 9 104203329 missense possibly damaging 0.86
R5452:Dnajc13 UTSW 9 104192114 missense probably benign 0.01
R5657:Dnajc13 UTSW 9 104228537 missense probably damaging 1.00
R5752:Dnajc13 UTSW 9 104192774 splice site probably null
R5789:Dnajc13 UTSW 9 104214188 missense probably damaging 1.00
R5837:Dnajc13 UTSW 9 104176666 missense possibly damaging 0.88
R5846:Dnajc13 UTSW 9 104190385 missense probably damaging 0.99
R5982:Dnajc13 UTSW 9 104184615 missense possibly damaging 0.77
R6189:Dnajc13 UTSW 9 104213886 missense probably benign 0.12
R6355:Dnajc13 UTSW 9 104203270 missense probably damaging 0.99
R6483:Dnajc13 UTSW 9 104207804 missense probably damaging 0.96
R6613:Dnajc13 UTSW 9 104213877 missense probably benign 0.07
R6962:Dnajc13 UTSW 9 104181009 missense probably benign 0.02
R7048:Dnajc13 UTSW 9 104203414 critical splice donor site probably null
R7101:Dnajc13 UTSW 9 104165022 missense possibly damaging 0.92
R7304:Dnajc13 UTSW 9 104238514 missense probably benign 0.00
R7353:Dnajc13 UTSW 9 104230031 missense possibly damaging 0.89
R7528:Dnajc13 UTSW 9 104178965 missense possibly damaging 0.65
R7635:Dnajc13 UTSW 9 104162367 missense probably benign
R7673:Dnajc13 UTSW 9 104233692 missense probably benign 0.09
X0017:Dnajc13 UTSW 9 104238478 missense possibly damaging 0.90
X0028:Dnajc13 UTSW 9 104165018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGCAAAACAAGTAACCCAG -3'
(R):5'- GTCCTTGGATACTTACTCAGGGG -3'

Sequencing Primer
(F):5'- TTGCAAAACAAGTAACCCAGTAAGG -3'
(R):5'- GGGAAAGTGTAGTACCTTCTTACAG -3'
Posted On2019-09-13