Mutagenetix > Incidental Mutations

Incidental Mutation 'R7366:Cdh23'

571813

Institutional Source

Beutler Lab

Gene Symbol

Cdh23

Ensembl Gene

ENSMUSG00000012819

Gene Name

cadherin 23 (otocadherin)

Synonyms

nmf252, bob, ahl, mdfw, 4930542A03Rik, sals, nmf112, nmf181, USH1D

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.539) question?

Stock #

R7366 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

60302748-60696490 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 60315692 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 2471 (Y2471*)

Ref Sequence

ENSEMBL: ENSMUSP00000101101 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073242] [ENSMUST00000105461] [ENSMUST00000105462] [ENSMUST00000105463] [ENSMUST00000105464]

Predicted Effect

probably null
Transcript: ENSMUST00000073242
AA Change: Y2470*

SMART Domains

Protein: ENSMUSP00000072973
Gene: ENSMUSG00000012819
AA Change: Y2470*

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	8.11e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1415	1.21e-18	SMART
CA	1440	1524	2.38e-26	SMART
CA	1549	1631	6.27e-26	SMART
CA	1656	1741	6.99e-24	SMART
CA	1765	1848	3.49e-24	SMART
CA	1872	1956	2.78e-18	SMART
CA	1984	2066	5.6e-14	SMART
CA	2090	2171	2.59e-27	SMART
CA	2195	2290	2.87e-11	SMART
CA	2317	2399	1.01e-20	SMART
CA	2423	2506	1.09e-25	SMART
CA	2530	2608	7.91e-23	SMART
CA	2634	2719	1.06e-23	SMART
CA	2750	2843	2e-10	SMART
Blast:CA	2867	2956	4e-51	BLAST
transmembrane domain	3067	3089	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000105461
AA Change: Y2471*

SMART Domains

Protein: ENSMUSP00000101101
Gene: ENSMUSG00000012819
AA Change: Y2471*

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	1.25e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1416	5.26e-19	SMART
CA	1441	1525	2.38e-26	SMART
CA	1550	1632	6.27e-26	SMART
CA	1657	1742	6.99e-24	SMART
CA	1766	1849	3.49e-24	SMART
CA	1873	1957	2.78e-18	SMART
CA	1985	2067	5.6e-14	SMART
CA	2091	2172	2.59e-27	SMART
CA	2196	2291	2.87e-11	SMART
CA	2318	2400	1.01e-20	SMART
CA	2424	2507	1.09e-25	SMART
CA	2531	2609	7.91e-23	SMART
CA	2635	2720	1.06e-23	SMART
CA	2751	2844	2e-10	SMART
Blast:CA	2868	2957	4e-51	BLAST
transmembrane domain	3068	3090	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000105462
AA Change: Y2473*

SMART Domains

Protein: ENSMUSP00000101102
Gene: ENSMUSG00000012819
AA Change: Y2473*

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	261	349	2.03e-11	SMART
CA	374	461	8.11e-11	SMART
CA	485	562	1.04e-22	SMART
CA	586	672	3.55e-25	SMART
CA	696	779	2.04e-25	SMART
CA	803	891	5.03e-16	SMART
CA	915	996	1.05e-27	SMART
CA	1020	1103	1.99e-19	SMART
CA	1127	1209	6.94e-19	SMART
CA	1234	1314	1.99e-19	SMART
CA	1338	1418	1.21e-18	SMART
CA	1443	1527	2.38e-26	SMART
CA	1552	1634	6.27e-26	SMART
CA	1659	1744	6.99e-24	SMART
CA	1768	1851	3.49e-24	SMART
CA	1875	1959	2.78e-18	SMART
CA	1987	2069	5.6e-14	SMART
CA	2093	2174	2.59e-27	SMART
CA	2198	2293	2.87e-11	SMART
CA	2320	2402	1.01e-20	SMART
CA	2426	2509	1.09e-25	SMART
CA	2533	2611	7.91e-23	SMART
CA	2637	2722	1.06e-23	SMART
CA	2753	2846	2e-10	SMART
Blast:CA	2870	2959	4e-51	BLAST
transmembrane domain	3070	3092	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000105463
AA Change: Y2471*

SMART Domains

Protein: ENSMUSP00000101103
Gene: ENSMUSG00000012819
AA Change: Y2471*

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	1.25e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1416	5.26e-19	SMART
CA	1441	1525	2.38e-26	SMART
CA	1550	1632	6.27e-26	SMART
CA	1657	1742	6.99e-24	SMART
CA	1766	1849	3.49e-24	SMART
CA	1873	1957	2.78e-18	SMART
CA	1985	2067	5.6e-14	SMART
CA	2091	2172	2.59e-27	SMART
CA	2196	2291	2.87e-11	SMART
CA	2318	2400	1.01e-20	SMART
CA	2424	2507	1.09e-25	SMART
CA	2531	2609	7.91e-23	SMART
CA	2635	2720	1.06e-23	SMART
CA	2751	2844	2e-10	SMART
Blast:CA	2868	2957	4e-51	BLAST
transmembrane domain	3068	3090	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000105464
AA Change: Y2469*

SMART Domains

Protein: ENSMUSP00000101104
Gene: ENSMUSG00000012819
AA Change: Y2469*

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	456	3.58e-12	SMART
CA	480	557	1.04e-22	SMART
CA	581	667	3.55e-25	SMART
CA	691	774	2.04e-25	SMART
CA	798	886	5.03e-16	SMART
CA	910	991	1.05e-27	SMART
CA	1015	1098	1.99e-19	SMART
CA	1122	1204	6.94e-19	SMART
CA	1229	1309	1.99e-19	SMART
CA	1333	1414	5.26e-19	SMART
CA	1439	1523	2.38e-26	SMART
CA	1548	1630	6.27e-26	SMART
CA	1655	1740	6.99e-24	SMART
CA	1764	1847	3.49e-24	SMART
CA	1871	1955	2.78e-18	SMART
CA	1983	2065	5.6e-14	SMART
CA	2089	2170	2.59e-27	SMART
CA	2194	2289	2.87e-11	SMART
CA	2316	2398	1.01e-20	SMART
CA	2422	2505	1.09e-25	SMART
CA	2529	2607	7.91e-23	SMART
CA	2633	2718	1.06e-23	SMART
CA	2749	2842	2e-10	SMART
Blast:CA	2866	2955	3e-51	BLAST
transmembrane domain	3066	3088	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, whose genes encode calcium dependent cell-cell adhesion glycoproteins. The encoded protein is thought to be involved in stereocilia organization and hair bundle formation. The gene is located in a region containing the human deafness loci DFNB12 and USH1D. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of this cadherin-like gene. Upregulation of this gene may also be associated with breast cancer. Alternative splice variants encoding different isoforms have been described. [provided by RefSeq, May 2013]
PHENOTYPE: Mutant mice exhibit circling behavior, tilting of the head and are deaf. Mice homozygous for a targeted knock-out exhibit abnormal outer hair cells morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030K09Rik	C	T	8: 72,449,459	P244S	possibly damaging	Het
4930404N11Rik	T	C	10: 81,364,191	D165G	possibly damaging	Het
4930562C15Rik	A	G	16: 4,835,769	I61V	unknown	Het
Abcb11	C	T	2: 69,299,867	D282N	probably damaging	Het
Acbd3	A	G	1: 180,734,499	E181G	probably benign	Het
Ano3	T	C	2: 110,757,067	Y43C	probably damaging	Het
Aspa	T	A	11: 73,319,890		probably null	Het
AU018091	A	T	7: 3,156,330	N620K	probably damaging	Het
Bicc1	G	T	10: 70,943,386	T724K	probably benign	Het
Bmper	T	C	9: 23,484,004	I677T	probably damaging	Het
C3	T	A	17: 57,221,162	T686S	probably benign	Het
Cc2d2a	G	T	5: 43,729,990	R1315L	probably damaging	Het
Ccdc150	G	T	1: 54,300,382	E462*	probably null	Het
Ccdc88c	C	A	12: 100,944,950	R875L	possibly damaging	Het
Cd177	C	T	7: 24,756,722	G207D	probably damaging	Het
Cmbl	A	T	15: 31,589,856	Y244F	probably benign	Het
Dcaf10	T	C	4: 45,373,919	V448A	probably damaging	Het
Ddr2	A	G	1: 169,997,964	W356R	probably damaging	Het
Depdc1a	A	G	3: 159,523,212	I534V	probably benign	Het
Dhtkd1	T	A	2: 5,917,906	I481L	probably benign	Het
Dlst	A	T	12: 85,128,315	I260L	probably benign	Het
Dnajc13	T	G	9: 104,184,706	K1350Q	probably benign	Het
Dpp4	T	C	2: 62,354,599	Y520C	probably damaging	Het
Dr1	C	A	5: 108,275,728	A127E	unknown	Het
Dsel	C	T	1: 111,861,573	G411S	probably damaging	Het
E130308A19Rik	T	C	4: 59,752,770	C628R	probably damaging	Het
Fam20a	T	A	11: 109,673,342	Q528H	possibly damaging	Het
Fanca	T	C	8: 123,281,213	E981G	probably benign	Het
Fbp2	A	G	13: 62,837,198	V303A	possibly damaging	Het
Flii	C	T	11: 60,721,119	V353M	possibly damaging	Het
Gm10277	T	A	11: 77,785,758	Y129F	unknown	Het
Gm3159	A	T	14: 4,398,525	H72L	probably benign	Het
Gm5114	T	G	7: 39,409,344	T284P	possibly damaging	Het
Gm7168	T	C	17: 13,949,885	S505P	probably damaging	Het
Gnal	T	C	18: 67,211,071	V239A	possibly damaging	Het
Gtf2i	C	T	5: 134,265,749	E370K	probably damaging	Het
Hivep3	CGG	CG	4: 120,097,911		probably null	Het
Il3	T	A	11: 54,265,883	R93S	probably benign	Het
Itsn1	A	G	16: 91,908,450	E1573G	unknown	Het
Kif26a	G	A	12: 112,163,542		probably null	Het
Klb	T	C	5: 65,372,431	M434T	probably damaging	Het
Lrp2	T	A	2: 69,483,806	R2194W	probably damaging	Het
Mak16	A	G	8: 31,166,099	Y119H	possibly damaging	Het
Map3k19	T	A	1: 127,817,455	M1421L	probably damaging	Het
Mbd5	A	G	2: 49,274,568	I1186V	probably benign	Het
Mboat1	T	A	13: 30,202,362	C120S	possibly damaging	Het
Mctp2	T	A	7: 72,259,214	D117V	probably benign	Het
Mocos	C	A	18: 24,676,616	N425K	probably damaging	Het
Ngfr	A	T	11: 95,574,429	W198R	possibly damaging	Het
Nr4a3	T	G	4: 48,051,290	S15A	possibly damaging	Het
Obsl1	T	C	1: 75,502,964	S596G	probably damaging	Het
Olfr111	T	A	17: 37,530,817	V280D	probably damaging	Het
Olfr1414	A	G	1: 92,511,678	S117P	possibly damaging	Het
Olfr578	A	T	7: 102,984,516	I216K	probably damaging	Het
Olfr594	T	G	7: 103,220,533	Y272D	probably benign	Het
Olfr705	G	T	7: 106,873,396	P283Q	probably damaging	Het
Plcb3	T	C	19: 6,962,021	T530A	probably benign	Het
Prss40	A	T	1: 34,559,871	Y70*	probably null	Het
Ralgps1	T	C	2: 33,324,688	M61V	possibly damaging	Het
Rbp4	C	T	19: 38,124,962	R36H	possibly damaging	Het
Rnf125	A	G	18: 20,974,433	N7S	not run	Het
Rpe65	G	A	3: 159,624,729	S511N	probably benign	Het
Rspo4	A	T	2: 151,867,873	Y66F	probably damaging	Het
Ruvbl2	A	G	7: 45,422,149	S437P	probably benign	Het
Sele	C	A	1: 164,048,719	R12S	probably benign	Het
Sgo2b	T	A	8: 63,938,417	K139*	probably null	Het
Shroom3	C	A	5: 92,964,606	S1942*	probably null	Het
Slc12a9	G	A	5: 137,328,623	R191*	probably null	Het
Spag9	G	T	11: 94,108,521	V1088L	possibly damaging	Het
Sptb	T	G	12: 76,604,194	D1669A	probably damaging	Het
Sptlc2	A	G	12: 87,314,049		probably null	Het
Synpo2	A	G	3: 123,114,041	V542A	probably damaging	Het
Tecpr2	T	C	12: 110,915,480		probably null	Het
Tenm2	T	C	11: 36,069,414	T1029A	probably benign	Het
Tgoln1	G	C	6: 72,616,278	T73R	probably benign	Het
Tnfaip8l1	C	A	17: 56,171,897	N62K	probably damaging	Het
Tollip	A	G	7: 141,889,597	S174P	probably benign	Het
Trp53tg5	A	G	2: 164,471,107	I216T	possibly damaging	Het
Tssk5	A	G	15: 76,374,513	S58P	probably benign	Het
Ttc9b	T	C	7: 27,654,959	Y157H	probably damaging	Het
Tuba8	A	G	6: 121,222,912	Y185C	probably damaging	Het
Ubr2	C	T	17: 46,955,845	A1127T	probably damaging	Het
Urb1	CACTTAC	CAC	16: 90,772,573		probably benign	Het
Yipf3	T	A	17: 46,248,929	L57Q	possibly damaging	Het
Zbtb32	A	C	7: 30,590,181	C19G	probably damaging	Het
Zfp735	A	T	11: 73,712,153	H641L	possibly damaging	Het
Zfyve28	A	T	5: 34,232,227	Y210N	probably damaging	Het

Other mutations in Cdh23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Cdh23	APN	10	60523548	missense	probably benign	0.03
IGL00429:Cdh23	APN	10	60421141	missense	probably damaging	0.97
IGL01014:Cdh23	APN	10	60307522	missense	probably damaging	0.99
IGL01284:Cdh23	APN	10	60466097	missense	possibly damaging	0.95
IGL01305:Cdh23	APN	10	60312624	missense	probably damaging	1.00
IGL01367:Cdh23	APN	10	60310787	missense	probably damaging	1.00
IGL01396:Cdh23	APN	10	60385069	missense	possibly damaging	0.93
IGL01412:Cdh23	APN	10	60314694	missense	probably damaging	1.00
IGL01461:Cdh23	APN	10	60409147	missense	possibly damaging	0.53
IGL01469:Cdh23	APN	10	60597725	missense	probably benign	0.03
IGL01695:Cdh23	APN	10	60331833	missense	probably benign	0.20
IGL01734:Cdh23	APN	10	60303513	missense	probably benign
IGL01767:Cdh23	APN	10	60315724	missense	probably damaging	1.00
IGL01796:Cdh23	APN	10	60311137	missense	probably benign	0.31
IGL01843:Cdh23	APN	10	60419819	splice site	probably null
IGL02025:Cdh23	APN	10	60385143	missense	probably damaging	1.00
IGL02071:Cdh23	APN	10	60523560	missense	possibly damaging	0.93
IGL02160:Cdh23	APN	10	60597765	splice site	probably benign
IGL02175:Cdh23	APN	10	60331308	missense	possibly damaging	0.92
IGL02220:Cdh23	APN	10	60305124	missense	probably damaging	1.00
IGL02302:Cdh23	APN	10	60323523	missense	possibly damaging	0.87
IGL02331:Cdh23	APN	10	60465543	missense	probably damaging	0.99
IGL02452:Cdh23	APN	10	60317942	missense	probably damaging	0.99
IGL02499:Cdh23	APN	10	60385179	missense	probably damaging	1.00
IGL02548:Cdh23	APN	10	60650122	missense	probably benign	0.37
IGL02593:Cdh23	APN	10	60465995	splice site	probably benign
IGL02626:Cdh23	APN	10	60391801	missense	probably damaging	1.00
IGL02951:Cdh23	APN	10	60311364	missense	probably damaging	1.00
IGL03145:Cdh23	APN	10	60376814	missense	probably damaging	0.99
dee_dee	UTSW	10	60308056	nonsense	probably null
hersey	UTSW	10	60308036	missense	probably damaging	1.00
ANU22:Cdh23	UTSW	10	60312624	missense	probably damaging	1.00
IGL02980:Cdh23	UTSW	10	60314620	missense	probably damaging	1.00
PIT4362001:Cdh23	UTSW	10	60465458	missense	probably benign	0.15
R0013:Cdh23	UTSW	10	60413173	missense	possibly damaging	0.90
R0045:Cdh23	UTSW	10	60530978	missense	probably damaging	1.00
R0045:Cdh23	UTSW	10	60530978	missense	probably damaging	1.00
R0082:Cdh23	UTSW	10	60312587	missense	probably damaging	1.00
R0124:Cdh23	UTSW	10	60308056	nonsense	probably null
R0172:Cdh23	UTSW	10	60319632	missense	probably damaging	1.00
R0195:Cdh23	UTSW	10	60317059	missense	probably damaging	0.99
R0365:Cdh23	UTSW	10	60379315	missense	probably damaging	0.99
R0437:Cdh23	UTSW	10	60410797	missense	probably damaging	1.00
R0486:Cdh23	UTSW	10	60386946	missense	probably damaging	1.00
R0494:Cdh23	UTSW	10	60316596	splice site	probably benign
R0545:Cdh23	UTSW	10	60331291	missense	probably benign	0.06
R0619:Cdh23	UTSW	10	60433777	missense	probably damaging	1.00
R0647:Cdh23	UTSW	10	60307902	missense	probably damaging	0.99
R0647:Cdh23	UTSW	10	60323374	nonsense	probably null
R0730:Cdh23	UTSW	10	60323714	missense	probably damaging	0.99
R0880:Cdh23	UTSW	10	60406421	missense	possibly damaging	0.51
R0942:Cdh23	UTSW	10	60410860	missense	possibly damaging	0.67
R0989:Cdh23	UTSW	10	60534510	missense	probably damaging	0.99
R1017:Cdh23	UTSW	10	60331793	missense	probably damaging	1.00
R1173:Cdh23	UTSW	10	60312392	splice site	probably benign
R1449:Cdh23	UTSW	10	60376951	missense	probably damaging	1.00
R1456:Cdh23	UTSW	10	60487120	missense	possibly damaging	0.84
R1519:Cdh23	UTSW	10	60379343	missense	possibly damaging	0.92
R1532:Cdh23	UTSW	10	60314331	missense	probably damaging	0.99
R1559:Cdh23	UTSW	10	60419699	splice site	probably benign
R1704:Cdh23	UTSW	10	60314611	missense	probably damaging	1.00
R1711:Cdh23	UTSW	10	60523536	missense	probably benign	0.07
R1760:Cdh23	UTSW	10	60326076	missense	probably damaging	1.00
R1782:Cdh23	UTSW	10	60488542	missense	probably damaging	1.00
R1791:Cdh23	UTSW	10	60391726	missense	possibly damaging	0.89
R1803:Cdh23	UTSW	10	60331281	missense	probably damaging	1.00
R1857:Cdh23	UTSW	10	60323297	missense	probably damaging	1.00
R1874:Cdh23	UTSW	10	60436818	missense	possibly damaging	0.52
R1914:Cdh23	UTSW	10	60323570	missense	probably damaging	0.99
R1958:Cdh23	UTSW	10	60410873	missense	probably benign	0.02
R1964:Cdh23	UTSW	10	60385222	missense	probably benign	0.31
R1966:Cdh23	UTSW	10	60323582	missense	probably damaging	1.00
R1981:Cdh23	UTSW	10	60378751	missense	probably damaging	1.00
R2010:Cdh23	UTSW	10	60314227	missense	probably damaging	0.99
R2036:Cdh23	UTSW	10	60466043	missense	possibly damaging	0.52
R2038:Cdh23	UTSW	10	60312587	missense	probably damaging	1.00
R2044:Cdh23	UTSW	10	60596730	missense	possibly damaging	0.72
R2111:Cdh23	UTSW	10	60305583	missense	probably damaging	0.99
R2112:Cdh23	UTSW	10	60305583	missense	probably damaging	0.99
R2211:Cdh23	UTSW	10	60466004	missense	possibly damaging	0.92
R2261:Cdh23	UTSW	10	60317128	missense	probably damaging	1.00
R2262:Cdh23	UTSW	10	60317128	missense	probably damaging	1.00
R2306:Cdh23	UTSW	10	60323445	missense	probably damaging	1.00
R2344:Cdh23	UTSW	10	60316724	missense	probably damaging	1.00
R2857:Cdh23	UTSW	10	60382653	critical splice donor site	probably null
R2858:Cdh23	UTSW	10	60382653	critical splice donor site	probably null
R2859:Cdh23	UTSW	10	60382653	critical splice donor site	probably null
R2876:Cdh23	UTSW	10	60307496	missense	probably damaging	1.00
R3034:Cdh23	UTSW	10	60409010	splice site	probably benign
R3424:Cdh23	UTSW	10	60376881	missense	possibly damaging	0.76
R3699:Cdh23	UTSW	10	60327370	critical splice donor site	probably null
R3700:Cdh23	UTSW	10	60327370	critical splice donor site	probably null
R3950:Cdh23	UTSW	10	60657326	missense	probably benign	0.04
R3951:Cdh23	UTSW	10	60657326	missense	probably benign	0.04
R3952:Cdh23	UTSW	10	60657326	missense	probably benign	0.04
R4108:Cdh23	UTSW	10	60410822	missense	possibly damaging	0.51
R4114:Cdh23	UTSW	10	60421040	splice site	probably null
R4273:Cdh23	UTSW	10	60311161	missense	possibly damaging	0.69
R4284:Cdh23	UTSW	10	60303493	missense	possibly damaging	0.91
R4334:Cdh23	UTSW	10	60385059	missense	probably damaging	0.99
R4474:Cdh23	UTSW	10	60311086	missense	probably damaging	1.00
R4532:Cdh23	UTSW	10	60534423	missense	probably benign	0.32
R4597:Cdh23	UTSW	10	60409044	missense	probably damaging	1.00
R4604:Cdh23	UTSW	10	60337666	missense	possibly damaging	0.93
R4793:Cdh23	UTSW	10	60331350	missense	probably damaging	1.00
R4816:Cdh23	UTSW	10	60409077	missense	possibly damaging	0.93
R4833:Cdh23	UTSW	10	60385038	missense	probably damaging	1.00
R4840:Cdh23	UTSW	10	60419777	missense	possibly damaging	0.53
R4857:Cdh23	UTSW	10	60391784	missense	probably damaging	1.00
R4869:Cdh23	UTSW	10	60376934	missense	probably damaging	1.00
R4894:Cdh23	UTSW	10	60337851	missense	probably benign	0.04
R4940:Cdh23	UTSW	10	60307935	missense	probably damaging	0.98
R5020:Cdh23	UTSW	10	60308032	missense	probably damaging	0.99
R5026:Cdh23	UTSW	10	60304848	missense	possibly damaging	0.88
R5081:Cdh23	UTSW	10	60436807	missense	possibly damaging	0.89
R5138:Cdh23	UTSW	10	60312282	missense	probably damaging	1.00
R5236:Cdh23	UTSW	10	60312572	missense	probably damaging	1.00
R5361:Cdh23	UTSW	10	60657265	critical splice donor site	probably null
R5384:Cdh23	UTSW	10	60337762	missense	probably damaging	0.99
R5500:Cdh23	UTSW	10	60314311	missense	probably damaging	1.00
R5512:Cdh23	UTSW	10	60534386	splice site	probably null
R5673:Cdh23	UTSW	10	60307857	missense	probably damaging	1.00
R5720:Cdh23	UTSW	10	60393023	missense	possibly damaging	0.71
R5726:Cdh23	UTSW	10	60407480	missense	probably damaging	0.98
R5732:Cdh23	UTSW	10	60331317	missense	possibly damaging	0.80
R5739:Cdh23	UTSW	10	60305609	missense	probably damaging	0.99
R5760:Cdh23	UTSW	10	60406392	missense	probably damaging	0.99
R5793:Cdh23	UTSW	10	60306128	missense	probably damaging	1.00
R5880:Cdh23	UTSW	10	60384934	missense	probably damaging	1.00
R5905:Cdh23	UTSW	10	60534535	missense	probably damaging	0.98
R5907:Cdh23	UTSW	10	60428379	missense	probably damaging	1.00
R5910:Cdh23	UTSW	10	60377821	missense	possibly damaging	0.81
R5932:Cdh23	UTSW	10	60392984	missense	probably damaging	1.00
R5996:Cdh23	UTSW	10	60413577	missense	possibly damaging	0.85
R6015:Cdh23	UTSW	10	60307982	missense	probably damaging	0.97
R6020:Cdh23	UTSW	10	60331326	missense	probably damaging	1.00
R6023:Cdh23	UTSW	10	60465542	missense	probably damaging	1.00
R6028:Cdh23	UTSW	10	60534535	missense	probably damaging	0.98
R6066:Cdh23	UTSW	10	60433758	missense	probably damaging	1.00
R6137:Cdh23	UTSW	10	60434512	missense	probably damaging	0.96
R6211:Cdh23	UTSW	10	60410821	missense	possibly damaging	0.90
R6298:Cdh23	UTSW	10	60426672	nonsense	probably null
R6302:Cdh23	UTSW	10	60305093	missense	possibly damaging	0.74
R6338:Cdh23	UTSW	10	60413151	missense	probably damaging	1.00
R6356:Cdh23	UTSW	10	60438847	missense	probably damaging	1.00
R6441:Cdh23	UTSW	10	60308036	missense	probably damaging	1.00
R6714:Cdh23	UTSW	10	60331830	missense	possibly damaging	0.62
R6760:Cdh23	UTSW	10	60306168	missense	probably damaging	1.00
R6807:Cdh23	UTSW	10	60378871	missense	possibly damaging	0.95
R6855:Cdh23	UTSW	10	60306122	missense	possibly damaging	0.66
R6937:Cdh23	UTSW	10	60487114	missense	probably damaging	1.00
R6942:Cdh23	UTSW	10	60438856	missense	possibly damaging	0.93
R6961:Cdh23	UTSW	10	60650114	missense	probably benign	0.00
R7009:Cdh23	UTSW	10	60337306	missense	probably damaging	0.99
R7010:Cdh23	UTSW	10	60530991	missense	probably benign	0.03
R7032:Cdh23	UTSW	10	60331788	missense	probably damaging	1.00
R7046:Cdh23	UTSW	10	60378751	missense	probably damaging	1.00
R7111:Cdh23	UTSW	10	60387044	missense	probably damaging	1.00
R7196:Cdh23	UTSW	10	60307980	missense	probably damaging	0.99
R7198:Cdh23	UTSW	10	60312599	missense	possibly damaging	0.91
R7223:Cdh23	UTSW	10	60331817	missense	probably damaging	1.00
R7290:Cdh23	UTSW	10	60376841	missense	probably benign
R7335:Cdh23	UTSW	10	60305116	missense	probably damaging	1.00
R7340:Cdh23	UTSW	10	60530996	missense	probably benign	0.19
R7350:Cdh23	UTSW	10	60410910	missense	probably damaging	1.00
R7374:Cdh23	UTSW	10	60317900	missense	probably damaging	0.99
R7455:Cdh23	UTSW	10	60306224	missense	possibly damaging	0.82
R7537:Cdh23	UTSW	10	60384945	missense	probably benign	0.17
R7573:Cdh23	UTSW	10	60323550	missense	probably benign	0.17
R7578:Cdh23	UTSW	10	60407407	missense	probably benign	0.14
R7646:Cdh23	UTSW	10	60305152	missense	possibly damaging	0.95
R7703:Cdh23	UTSW	10	60337264	missense	probably damaging	1.00
X0052:Cdh23	UTSW	10	60385134	missense	probably damaging	1.00
Z1088:Cdh23	UTSW	10	60413644	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- CTTCTTCCTGAAGCCACAGC -3'
(R):5'- TGGGCTAGTCACTCCATCTCAG -3'

Sequencing Primer
(F):5'- AGCAGCCAACATCTCATCTTTC -3'
(R):5'- CTCCATCTCAGATAGAATGTGGTAGG -3'

Posted On

2019-09-13