Incidental Mutation 'R0646:Gm884'
ID 57184
Institutional Source Beutler Lab
Gene Symbol Gm884
Ensembl Gene ENSMUSG00000034239
Gene Name predicted gene 884
Synonyms LOC380730
MMRRC Submission 038831-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock # R0646 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 103534577-103621140 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 103613160 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 485 (K485*)
Ref Sequence ENSEMBL: ENSMUSP00000129662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059279] [ENSMUST00000167262]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000059279
AA Change: K2661*
SMART Domains Protein: ENSMUSP00000058511
Gene: ENSMUSG00000034239
AA Change: K2661*

DomainStartEndE-ValueType
Pfam:LRRC37 149 223 5.4e-10 PFAM
low complexity region 244 264 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
Pfam:LRRC37 335 403 1.9e-14 PFAM
Pfam:LRRC37 419 514 1.2e-8 PFAM
Pfam:LRRC37 565 620 2e-10 PFAM
Pfam:LRRC37 669 739 7.6e-18 PFAM
Pfam:LRRC37 741 792 1.6e-9 PFAM
Pfam:LRRC37 789 860 1.4e-23 PFAM
Pfam:LRRC37 861 914 2.8e-9 PFAM
Pfam:LRRC37 911 983 1.9e-23 PFAM
Pfam:LRRC37 979 1038 1e-8 PFAM
Pfam:LRRC37 1034 1105 2.7e-24 PFAM
Pfam:LRRC37 1105 1158 2.3e-9 PFAM
Pfam:LRRC37 1155 1219 2.4e-17 PFAM
Pfam:LRRC37 1222 1265 9.2e-7 PFAM
Pfam:LRRC37 1263 1330 4.9e-24 PFAM
Pfam:LRRC37 1331 1384 1.4e-10 PFAM
Pfam:LRRC37 1380 1451 4.3e-15 PFAM
Pfam:LRRC37 1487 1558 1.9e-15 PFAM
Pfam:LRRC37 1594 1665 2.9e-18 PFAM
Pfam:LRRC37 1701 1772 5.6e-23 PFAM
Pfam:LRRC37 1808 1910 2.8e-18 PFAM
Pfam:LRRC37 1915 1986 7.2e-17 PFAM
Pfam:LRRC37 2022 2093 4.9e-22 PFAM
Pfam:LRRC37 2129 2200 4.4e-22 PFAM
Pfam:LRRC37 2236 2307 2.1e-21 PFAM
Pfam:LRRC37 2343 2414 3.8e-17 PFAM
Pfam:LRRC37 2449 2519 1.6e-19 PFAM
LRR 2777 2796 3.09e1 SMART
LRR_TYP 2797 2820 2.09e-3 SMART
LRR 2821 2844 4.44e0 SMART
LRR 2848 2872 8.26e1 SMART
low complexity region 2991 3002 N/A INTRINSIC
low complexity region 3220 3230 N/A INTRINSIC
low complexity region 3382 3393 N/A INTRINSIC
Pfam:LRRC37AB_C 3424 3570 7.7e-76 PFAM
low complexity region 3571 3589 N/A INTRINSIC
low complexity region 3622 3640 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167262
AA Change: K485*
SMART Domains Protein: ENSMUSP00000129662
Gene: ENSMUSG00000034239
AA Change: K485*

DomainStartEndE-ValueType
internal_repeat_1 1 70 1.46e-11 PROSPERO
internal_repeat_1 108 290 1.46e-11 PROSPERO
LRR 601 620 3.09e1 SMART
LRR_TYP 621 644 2.09e-3 SMART
LRR 645 668 4.44e0 SMART
LRR 672 696 8.26e1 SMART
low complexity region 815 826 N/A INTRINSIC
low complexity region 1044 1054 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Pfam:LRRC37AB_C 1243 1396 1.2e-92 PFAM
low complexity region 1446 1464 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 95% (123/130)
Allele List at MGI
Other mutations in this stock
Total: 125 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik C T 11: 23,575,491 R716H probably damaging Het
4930432E11Rik C T 7: 29,561,285 noncoding transcript Het
A430078G23Rik T C 8: 3,386,959 Y250H probably damaging Het
Abcb11 A G 2: 69,285,283 I579T probably damaging Het
Abcc9 T C 6: 142,682,104 N400S probably benign Het
Adarb2 T C 13: 8,731,819 L577P probably damaging Het
Agt A C 8: 124,557,113 N422K probably damaging Het
Ahnak A T 19: 9,013,402 K4017* probably null Het
Akap13 C A 7: 75,747,746 Q2575K probably damaging Het
Aldh3a2 A T 11: 61,253,715 I339K probably damaging Het
Alox15 G T 11: 70,345,624 Y483* probably null Het
Ampd1 A T 3: 103,099,597 I713F probably damaging Het
Amph A T 13: 19,113,116 E344V possibly damaging Het
Arid5b A G 10: 68,096,977 S1032P probably damaging Het
Armc8 C A 9: 99,505,688 L393F probably damaging Het
Bpnt1 A G 1: 185,345,426 probably null Het
Cachd1 G A 4: 100,988,221 R970H probably damaging Het
Cd207 T C 6: 83,675,756 T131A probably benign Het
Cd83 G A 13: 43,797,533 V54I probably benign Het
Cfap43 T C 19: 47,763,676 K1086E probably benign Het
Cfap65 A T 1: 74,902,169 V1837E probably benign Het
Clcnka T A 4: 141,396,606 H89L probably benign Het
Cnga4 T C 7: 105,404,975 I50T possibly damaging Het
Cog5 A G 12: 31,837,359 probably benign Het
Col11a2 T A 17: 34,059,348 probably null Het
Col28a1 T G 6: 8,175,291 I186L possibly damaging Het
Col4a2 T A 8: 11,431,252 M808K probably benign Het
Copb2 A G 9: 98,563,475 probably benign Het
Dbnl G A 11: 5,795,441 probably benign Het
Dbx2 T C 15: 95,654,612 T51A possibly damaging Het
Dcp1a A T 14: 30,502,885 M123L probably damaging Het
Ddx42 T A 11: 106,232,833 F217I probably benign Het
Dlc1 T C 8: 36,858,051 T367A probably benign Het
Dmgdh A T 13: 93,752,355 T834S probably benign Het
Dnah8 T C 17: 30,684,173 S929P probably damaging Het
Dnase1l2 C A 17: 24,441,082 V271L possibly damaging Het
Dsc1 T C 18: 20,096,057 Y392C probably damaging Het
Edn1 T C 13: 42,305,242 probably benign Het
Eps8l3 T C 3: 107,884,810 L351P probably damaging Het
F12 G A 13: 55,422,483 probably benign Het
Fam47e T C 5: 92,578,458 probably benign Het
Fcrl5 C A 3: 87,442,013 Q32K probably benign Het
Fndc1 C T 17: 7,741,673 V1637I possibly damaging Het
Foxg1 G T 12: 49,384,567 probably benign Het
Frrs1 A T 3: 116,902,421 I530F possibly damaging Het
Galnt5 A T 2: 57,999,085 K232N probably benign Het
Ggt5 G A 10: 75,602,648 V68M probably damaging Het
Gm11639 G A 11: 104,720,501 D390N probably benign Het
Gm13084 A C 4: 143,812,585 S113A possibly damaging Het
Gm16519 T C 17: 70,929,106 C17R probably benign Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Gm9631 T G 11: 121,945,629 D28A probably damaging Het
Gpx2 T C 12: 76,795,313 I21M probably benign Het
H2-Q2 T G 17: 35,345,685 D354E probably damaging Het
Icam2 A T 11: 106,380,891 I71K probably damaging Het
Il12a T C 3: 68,697,890 probably benign Het
Insm2 C G 12: 55,600,440 A323G probably benign Het
Itga1 T C 13: 114,968,299 T1064A probably benign Het
Itgad T A 7: 128,174,004 V11E possibly damaging Het
Kctd15 C T 7: 34,644,881 S115N probably damaging Het
Klra5 A G 6: 129,903,564 W124R probably damaging Het
Kng2 T A 16: 22,987,736 D571V probably benign Het
Kpna6 A T 4: 129,650,790 F380I probably benign Het
Lipo1 A T 19: 33,784,769 Y109* probably null Het
Man2a2 T C 7: 80,363,197 H540R possibly damaging Het
Map2k4 T C 11: 65,712,275 E188G probably damaging Het
Mast4 T C 13: 102,758,744 probably benign Het
Mbtd1 A G 11: 93,905,212 D25G probably damaging Het
Med13 T A 11: 86,331,089 Q238L possibly damaging Het
Mmachc A G 4: 116,703,654 Y215H probably damaging Het
Mtor T A 4: 148,484,354 Y1110* probably null Het
Nek2 A G 1: 191,822,219 N57D probably damaging Het
Nek7 ACCCC ACCC 1: 138,515,693 probably null Het
Neo1 G T 9: 58,931,034 T489K probably damaging Het
Neu1 T A 17: 34,934,760 Y387N probably damaging Het
Nfasc A T 1: 132,608,438 C586* probably null Het
Nle1 G A 11: 82,904,845 L259F probably damaging Het
Nrde2 G A 12: 100,143,846 Q309* probably null Het
Nufip2 C T 11: 77,686,453 H76Y probably benign Het
Olfr1330 A C 4: 118,893,490 T136P probably damaging Het
Olfr1383 A T 11: 49,524,578 N285I probably damaging Het
Olfr466 A T 13: 65,153,063 I280F probably damaging Het
Olfr584 T C 7: 103,086,151 F206S probably damaging Het
Olfr670 A T 7: 104,959,811 I307N probably benign Het
Olfr731 A T 14: 50,238,639 I82N probably damaging Het
Pcdhb5 A G 18: 37,321,622 T352A probably benign Het
Pcdhb7 A T 18: 37,343,389 D526V probably damaging Het
Phkg1 A T 5: 129,864,553 probably null Het
Plg C T 17: 12,418,736 T744M probably damaging Het
Plxnd1 A C 6: 115,958,699 probably benign Het
Poglut1 A T 16: 38,529,475 I312N probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Ppt1 A G 4: 122,844,099 M77V probably benign Het
Pramel5 G T 4: 144,271,620 T351N probably damaging Het
Psmb4 G A 3: 94,884,964 R216C probably benign Het
Ptprd T C 4: 76,084,403 T699A probably damaging Het
Retreg3 A T 11: 101,098,629 probably benign Het
Scaper G A 9: 55,758,056 A389V probably damaging Het
Serinc5 G A 13: 92,688,737 D225N possibly damaging Het
Slco1a1 T G 6: 141,925,754 probably benign Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Sod3 A T 5: 52,368,079 D40V probably benign Het
Sorcs3 C A 19: 48,206,295 A39E probably benign Het
Spon1 A T 7: 114,039,821 T761S probably benign Het
Syde2 A G 3: 146,014,249 probably null Het
Synm T A 7: 67,759,168 D154V probably benign Het
Synpo2 T C 3: 123,114,449 E406G probably damaging Het
Tcea3 T A 4: 136,248,071 L8* probably null Het
Tec G A 5: 72,823,497 L33F probably damaging Het
Tex15 T A 8: 33,582,326 S2634T possibly damaging Het
Tg T A 15: 66,729,626 Y162N probably damaging Het
Tmem8b G A 4: 43,690,123 V853I probably benign Het
Togaram1 A G 12: 65,021,466 K1748E probably damaging Het
Ttn T C 2: 76,898,478 probably benign Het
Usp36 C T 11: 118,273,021 D234N probably damaging Het
Usp40 G A 1: 87,978,522 P664S probably benign Het
Vmn1r54 T A 6: 90,269,653 L183H probably benign Het
Vmn1r58 T G 7: 5,410,677 I185L probably benign Het
Wnt8a A T 18: 34,547,565 R328W probably benign Het
Yars A G 4: 129,213,939 probably benign Het
Zbtb49 A C 5: 38,200,674 M745R probably damaging Het
Zeb1 T G 18: 5,759,027 F162V probably damaging Het
Zfp369 A T 13: 65,297,548 H835L probably damaging Het
Zic5 A G 14: 122,463,939 V460A unknown Het
Zp3 A G 5: 135,984,356 N181D possibly damaging Het
Other mutations in Gm884
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Gm884 APN 11 103615410 missense probably benign 0.01
IGL00576:Gm884 APN 11 103617386 unclassified probably benign
IGL00813:Gm884 APN 11 103614498 missense probably benign 0.05
IGL01311:Gm884 APN 11 103534676 missense unknown
IGL01946:Gm884 APN 11 103612933 missense probably benign 0.28
IGL02217:Gm884 APN 11 103612871 splice site probably benign
IGL02556:Gm884 APN 11 103613283 missense probably benign 0.01
IGL02825:Gm884 APN 11 103617068 unclassified probably benign
IGL02868:Gm884 APN 11 103615139 missense probably benign 0.10
IGL02904:Gm884 APN 11 103616361 unclassified probably benign
IGL03008:Gm884 APN 11 103620467 missense unknown
IGL03120:Gm884 APN 11 103616975 unclassified probably benign
IGL03159:Gm884 APN 11 103604502 splice site probably benign
IGL03181:Gm884 APN 11 103616416 unclassified probably benign
IGL03202:Gm884 APN 11 103615373 missense probably benign 0.03
IGL03263:Gm884 APN 11 103613699 missense possibly damaging 0.86
esteemed UTSW 11 103618830 missense unknown
lauded UTSW 11 103613103 missense possibly damaging 0.62
PIT4486001:Gm884 UTSW 11 103618201 missense unknown
R0040:Gm884 UTSW 11 103542990 missense probably damaging 0.99
R0135:Gm884 UTSW 11 103618047 unclassified probably benign
R0141:Gm884 UTSW 11 103613686 missense probably damaging 1.00
R0226:Gm884 UTSW 11 103603241 missense probably benign 0.08
R0547:Gm884 UTSW 11 103620164 missense unknown
R0685:Gm884 UTSW 11 103616888 unclassified probably benign
R0732:Gm884 UTSW 11 103619838 missense unknown
R1015:Gm884 UTSW 11 103545796 missense probably benign 0.01
R1166:Gm884 UTSW 11 103615383 missense probably benign 0.21
R1168:Gm884 UTSW 11 103618950 unclassified probably benign
R1257:Gm884 UTSW 11 103534641 missense unknown
R1545:Gm884 UTSW 11 103608919 missense probably benign 0.16
R1570:Gm884 UTSW 11 103609938 missense possibly damaging 0.76
R1677:Gm884 UTSW 11 103614942 missense probably benign 0.19
R1703:Gm884 UTSW 11 103540874 missense probably benign 0.39
R1719:Gm884 UTSW 11 103617071 unclassified probably benign
R1752:Gm884 UTSW 11 103614555 missense possibly damaging 0.67
R1870:Gm884 UTSW 11 103620605 missense unknown
R2155:Gm884 UTSW 11 103620459 missense unknown
R2191:Gm884 UTSW 11 103618967 unclassified probably benign
R2271:Gm884 UTSW 11 103614207 missense possibly damaging 0.53
R2378:Gm884 UTSW 11 103619711 unclassified probably benign
R2405:Gm884 UTSW 11 103620984 missense unknown
R2864:Gm884 UTSW 11 103540918 missense probably benign 0.34
R3011:Gm884 UTSW 11 103613103 missense possibly damaging 0.62
R3415:Gm884 UTSW 11 103614609 missense possibly damaging 0.82
R3417:Gm884 UTSW 11 103614609 missense possibly damaging 0.82
R3835:Gm884 UTSW 11 103620010 missense unknown
R3974:Gm884 UTSW 11 103619101 unclassified probably benign
R4019:Gm884 UTSW 11 103615293 missense probably benign 0.19
R4020:Gm884 UTSW 11 103615293 missense probably benign 0.19
R4176:Gm884 UTSW 11 103536600 missense unknown
R4361:Gm884 UTSW 11 103617501 frame shift probably null
R4418:Gm884 UTSW 11 103618314 unclassified probably benign
R4633:Gm884 UTSW 11 103619131 unclassified probably benign
R4693:Gm884 UTSW 11 103619860 missense unknown
R4758:Gm884 UTSW 11 103614464 missense possibly damaging 0.48
R4878:Gm884 UTSW 11 103617891 unclassified probably benign
R4887:Gm884 UTSW 11 103614872 missense probably benign 0.03
R4944:Gm884 UTSW 11 103613460 missense possibly damaging 0.68
R4952:Gm884 UTSW 11 103614207 missense possibly damaging 0.53
R5030:Gm884 UTSW 11 103534849 missense unknown
R5183:Gm884 UTSW 11 103543121 missense probably damaging 0.99
R5294:Gm884 UTSW 11 103616231 unclassified probably benign
R5317:Gm884 UTSW 11 103614145 missense possibly damaging 0.73
R5334:Gm884 UTSW 11 103613873 missense probably benign 0.18
R5426:Gm884 UTSW 11 103620760 missense unknown
R5467:Gm884 UTSW 11 103603265 nonsense probably null
R5518:Gm884 UTSW 11 103615253 missense probably benign 0.03
R5634:Gm884 UTSW 11 103542014 missense possibly damaging 0.95
R5647:Gm884 UTSW 11 103617474 unclassified probably benign
R5663:Gm884 UTSW 11 103613123 missense probably benign 0.01
R5668:Gm884 UTSW 11 103617054 unclassified probably benign
R5763:Gm884 UTSW 11 103613643 missense probably damaging 0.97
R5829:Gm884 UTSW 11 103541886 missense possibly damaging 0.95
R5871:Gm884 UTSW 11 103616454 unclassified probably benign
R5905:Gm884 UTSW 11 103614255 missense probably damaging 0.98
R5940:Gm884 UTSW 11 103613886 missense probably benign 0.18
R5964:Gm884 UTSW 11 103542120 missense possibly damaging 0.92
R5988:Gm884 UTSW 11 103615896 unclassified probably benign
R5992:Gm884 UTSW 11 103613792 missense possibly damaging 0.81
R6114:Gm884 UTSW 11 103617791 unclassified probably benign
R6154:Gm884 UTSW 11 103614143 missense probably benign 0.33
R6233:Gm884 UTSW 11 103613388 missense probably damaging 0.98
R6301:Gm884 UTSW 11 103618930 unclassified probably benign
R6362:Gm884 UTSW 11 103620652 missense unknown
R6471:Gm884 UTSW 11 103619622 unclassified probably benign
R6806:Gm884 UTSW 11 103621124 missense unknown
R6962:Gm884 UTSW 11 103614300 missense possibly damaging 0.67
R6996:Gm884 UTSW 11 103618757 nonsense probably null
R7028:Gm884 UTSW 11 103614537 missense probably benign 0.28
R7034:Gm884 UTSW 11 103615812 unclassified probably benign
R7036:Gm884 UTSW 11 103615812 unclassified probably benign
R7113:Gm884 UTSW 11 103618799 missense unknown
R7405:Gm884 UTSW 11 103615161 missense probably benign 0.02
R7420:Gm884 UTSW 11 103613625 missense probably benign 0.11
R7461:Gm884 UTSW 11 103616290 missense unknown
R7544:Gm884 UTSW 11 103615448 missense probably benign 0.01
R7613:Gm884 UTSW 11 103616290 missense unknown
R7711:Gm884 UTSW 11 103614912 missense probably benign 0.02
R7714:Gm884 UTSW 11 103616893 missense unknown
R7747:Gm884 UTSW 11 103614255 missense probably damaging 0.98
R7814:Gm884 UTSW 11 103614173 missense possibly damaging 0.53
R8053:Gm884 UTSW 11 103604566 missense unknown
R8063:Gm884 UTSW 11 103542261 missense unknown
R8116:Gm884 UTSW 11 103543289 missense unknown
R8124:Gm884 UTSW 11 103620431 missense unknown
R8141:Gm884 UTSW 11 103621029 missense unknown
R8163:Gm884 UTSW 11 103615862 missense unknown
R8270:Gm884 UTSW 11 103543315 missense unknown
R8348:Gm884 UTSW 11 103620900 missense unknown
R8362:Gm884 UTSW 11 103615337 missense probably benign 0.34
R8448:Gm884 UTSW 11 103620900 missense unknown
R8465:Gm884 UTSW 11 103616121 unclassified probably benign
R8473:Gm884 UTSW 11 103543440 missense unknown
R8781:Gm884 UTSW 11 103618132 missense unknown
R8821:Gm884 UTSW 11 103619644 missense unknown
R8859:Gm884 UTSW 11 103615544 missense unknown
R8888:Gm884 UTSW 11 103618830 missense unknown
R8895:Gm884 UTSW 11 103618830 missense unknown
R9083:Gm884 UTSW 11 103619004 missense unknown
R9085:Gm884 UTSW 11 103616739 missense unknown
R9088:Gm884 UTSW 11 103620936 missense unknown
R9124:Gm884 UTSW 11 103618895 missense unknown
R9177:Gm884 UTSW 11 103617437 missense unknown
R9238:Gm884 UTSW 11 103619033 missense unknown
R9267:Gm884 UTSW 11 103604580 missense unknown
Z1176:Gm884 UTSW 11 103613681 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- CAGTGTCTCATTTTCACACACGCAG -3'
(R):5'- CAATGCATCTTCAAGTCCCAATGCC -3'

Sequencing Primer
(F):5'- CACGCAGAAGTCACATATTTTGG -3'
(R):5'- TCCTTCAGAGATACCTGTGGAGAC -3'
Posted On 2013-07-11