Mutagenetix > Incidental Mutation

Incidental Mutation 'R7366:Ubr2'

571842

Institutional Source

Beutler Lab

Gene Symbol

Ubr2

Ensembl Gene

ENSMUSG00000023977

Gene Name

ubiquitin protein ligase E3 component n-recognin 2

Synonyms

9930021A08Rik, E130209G04Rik, ENSMUSG00000043296

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.865) question?

Stock #

R7366 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

46928295-47010556 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 46955845 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 1127 (A1127T)

Ref Sequence

ENSEMBL: ENSMUSP00000108961 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113335] [ENSMUST00000113337] [ENSMUST00000225599]

AlphaFold

Q6WKZ8

Predicted Effect

probably damaging
Transcript: ENSMUST00000113335
AA Change: A1127T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108961
Gene: ENSMUSG00000023977
AA Change: A1127T

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	3.14e-32	SMART
Pfam:ClpS	221	302	2.4e-23	PFAM
low complexity region	635	646	N/A	INTRINSIC
low complexity region	749	760	N/A	INTRINSIC
low complexity region	872	886	N/A	INTRINSIC
coiled coil region	1019	1046	N/A	INTRINSIC
RING	1108	1213	7.66e-1	SMART
low complexity region	1221	1235	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113337
AA Change: A1127T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108963
Gene: ENSMUSG00000023977
AA Change: A1127T

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	3.14e-32	SMART
Pfam:ClpS	222	301	6.2e-26	PFAM
low complexity region	635	646	N/A	INTRINSIC
low complexity region	749	760	N/A	INTRINSIC
low complexity region	872	886	N/A	INTRINSIC
coiled coil region	1019	1046	N/A	INTRINSIC
RING	1108	1213	7.66e-1	SMART
low complexity region	1221	1235	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000225599

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.1%

Validation Efficiency

99% (94/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin ligase of the N-end rule proteolytic pathway that targets proteins with destabilizing N-terminal residues for polyubiquitylation and proteasome-mediated degradation. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: On a mixed genetic background, female homozygotes for a targeted null mutation exhibit embryonic lethality, while males are viable, but sterile due to postnatal testicular degeneration. On an inbred background, both genders die in utero. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700023F06Rik	T	C	11: 103,208,118		probably null	Het
1700030K09Rik	C	T	8: 72,449,459	P244S	possibly damaging	Het
4930404N11Rik	T	C	10: 81,364,191	D165G	possibly damaging	Het
4930562C15Rik	A	G	16: 4,835,769	I61V	unknown	Het
Abcb11	C	T	2: 69,299,867	D282N	probably damaging	Het
Acbd3	A	G	1: 180,734,499	E181G	probably benign	Het
Ano3	T	C	2: 110,757,067	Y43C	probably damaging	Het
Aspa	T	A	11: 73,319,890		probably null	Het
AU018091	A	T	7: 3,156,330	N620K	probably damaging	Het
Bicc1	G	T	10: 70,943,386	T724K	probably benign	Het
Bmper	T	C	9: 23,484,004	I677T	probably damaging	Het
C3	T	A	17: 57,221,162	T686S	probably benign	Het
Cc2d2a	G	T	5: 43,729,990	R1315L	probably damaging	Het
Ccdc150	G	T	1: 54,300,382	E462*	probably null	Het
Ccdc88c	C	A	12: 100,944,950	R875L	possibly damaging	Het
Cd177	C	T	7: 24,756,722	G207D	probably damaging	Het
Cdh23	A	T	10: 60,315,692	Y2471*	probably null	Het
Cep89	G	A	7: 35,429,928	R630H	probably damaging	Het
Cmbl	A	T	15: 31,589,856	Y244F	probably benign	Het
Dcaf10	T	C	4: 45,373,919	V448A	probably damaging	Het
Ddr2	A	G	1: 169,997,964	W356R	probably damaging	Het
Depdc1a	A	G	3: 159,523,212	I534V	probably benign	Het
Dhtkd1	T	A	2: 5,917,906	I481L	probably benign	Het
Dlst	A	T	12: 85,128,315	I260L	probably benign	Het
Dnajc13	T	G	9: 104,184,706	K1350Q	probably benign	Het
Dpp4	T	C	2: 62,354,599	Y520C	probably damaging	Het
Dr1	C	A	5: 108,275,728	A127E	unknown	Het
Dsel	C	T	1: 111,861,573	G411S	probably damaging	Het
E130308A19Rik	T	C	4: 59,752,770	C628R	probably damaging	Het
Edem3	T	A	1: 151,812,614		probably null	Het
Fam20a	T	A	11: 109,673,342	Q528H	possibly damaging	Het
Fanca	T	C	8: 123,281,213	E981G	probably benign	Het
Fbp2	A	G	13: 62,837,198	V303A	possibly damaging	Het
Flii	C	T	11: 60,721,119	V353M	possibly damaging	Het
Gm10277	T	A	11: 77,785,758	Y129F	unknown	Het
Gm3159	A	T	14: 4,398,525	H72L	probably benign	Het
Gm5114	T	G	7: 39,409,344	T284P	possibly damaging	Het
Gm7168	T	C	17: 13,949,885	S505P	probably damaging	Het
Gnal	T	C	18: 67,211,071	V239A	possibly damaging	Het
Gtf2i	C	T	5: 134,265,749	E370K	probably damaging	Het
Hivep3	CGG	CG	4: 120,097,911	1141	probably null	Het
Il3	T	A	11: 54,265,883	R93S	probably benign	Het
Itsn1	A	G	16: 91,908,450	E1573G	unknown	Het
Kif26a	G	A	12: 112,163,542		probably null	Het
Klb	T	C	5: 65,372,431	M434T	probably damaging	Het
Lrp2	T	A	2: 69,483,806	R2194W	probably damaging	Het
Lrp6	G	T	6: 134,450,818	P1604T	probably damaging	Het
Mak16	A	G	8: 31,166,099	Y119H	possibly damaging	Het
Map3k19	T	A	1: 127,817,455	M1421L	probably damaging	Het
Mbd5	A	G	2: 49,274,568	I1186V	probably benign	Het
Mboat1	T	A	13: 30,202,362	C120S	possibly damaging	Het
Mctp2	T	A	7: 72,259,214	D117V	probably benign	Het
Mocos	C	A	18: 24,676,616	N425K	probably damaging	Het
Nav2	A	G	7: 49,554,203		probably null	Het
Ngfr	A	T	11: 95,574,429	W198R	possibly damaging	Het
Nr4a3	T	G	4: 48,051,290	S15A	possibly damaging	Het
Obsl1	T	C	1: 75,502,964	S596G	probably damaging	Het
Olfr111	T	A	17: 37,530,817	V280D	probably damaging	Het
Olfr1414	A	G	1: 92,511,678	S117P	possibly damaging	Het
Olfr578	A	T	7: 102,984,516	I216K	probably damaging	Het
Olfr594	T	G	7: 103,220,533	Y272D	probably benign	Het
Olfr705	G	T	7: 106,873,396	P283Q	probably damaging	Het
Pithd1	T	C	4: 135,987,050	Y29C	probably benign	Het
Plcb3	T	C	19: 6,962,021	T530A	probably benign	Het
Prss40	A	T	1: 34,559,871	Y70*	probably null	Het
Ralgps1	T	C	2: 33,324,688	M61V	possibly damaging	Het
Rbp4	C	T	19: 38,124,962	R36H	possibly damaging	Het
Rnf125	A	G	18: 20,974,433	N7S	not run	Het
Rpe65	G	A	3: 159,624,729	S511N	probably benign	Het
Rspo4	A	T	2: 151,867,873	Y66F	probably damaging	Het
Ruvbl2	A	G	7: 45,422,149	S437P	probably benign	Het
Sele	C	A	1: 164,048,719	R12S	probably benign	Het
Sgo2b	T	A	8: 63,938,417	K139*	probably null	Het
Shroom3	C	A	5: 92,964,606	S1942*	probably null	Het
Slc12a9	G	A	5: 137,328,623	R191*	probably null	Het
Spag9	G	T	11: 94,108,521	V1088L	possibly damaging	Het
Sptb	T	G	12: 76,604,194	D1669A	probably damaging	Het
Sptlc2	A	G	12: 87,314,049		probably null	Het
Sult2a8	A	T	7: 14,416,329		probably null	Het
Synpo2	A	G	3: 123,114,041	V542A	probably damaging	Het
Tecpr2	T	C	12: 110,915,480		probably null	Het
Tenm2	T	C	11: 36,069,414	T1029A	probably benign	Het
Tgoln1	G	C	6: 72,616,278	T73R	probably benign	Het
Tnfaip8l1	C	A	17: 56,171,897	N62K	probably damaging	Het
Tollip	A	G	7: 141,889,597	S174P	probably benign	Het
Trp53tg5	A	G	2: 164,471,107	I216T	possibly damaging	Het
Tssk5	A	G	15: 76,374,513	S58P	probably benign	Het
Ttc9b	T	C	7: 27,654,959	Y157H	probably damaging	Het
Tuba8	A	G	6: 121,222,912	Y185C	probably damaging	Het
Urb1	CACTTAC	CAC	16: 90,772,573		probably benign	Het
Yipf3	T	A	17: 46,248,929	L57Q	possibly damaging	Het
Zbtb32	A	C	7: 30,590,181	C19G	probably damaging	Het
Zfp735	A	T	11: 73,712,153	H641L	possibly damaging	Het
Zfyve28	A	T	5: 34,232,227	Y210N	probably damaging	Het
Zpr1	T	A	9: 46,273,373		probably null	Het

Other mutations in Ubr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Ubr2	APN	17	46986060	splice site	probably benign
IGL00332:Ubr2	APN	17	46990990	critical splice donor site	probably null
IGL00518:Ubr2	APN	17	46992996	missense	probably damaging	1.00
IGL00693:Ubr2	APN	17	46972981	missense	probably benign	0.01
IGL00785:Ubr2	APN	17	46944865	missense	possibly damaging	0.69
IGL01144:Ubr2	APN	17	46957321	missense	probably damaging	1.00
IGL01459:Ubr2	APN	17	46930509	splice site	probably benign
IGL01637:Ubr2	APN	17	46956654	missense	probably damaging	1.00
IGL01710:Ubr2	APN	17	46943409	missense	probably benign	0.00
IGL01726:Ubr2	APN	17	46992981	splice site	probably benign
IGL01925:Ubr2	APN	17	46954949	missense	possibly damaging	0.92
IGL01960:Ubr2	APN	17	46973967	missense	probably benign	0.45
IGL02170:Ubr2	APN	17	46967197	missense	probably benign	0.05
IGL02308:Ubr2	APN	17	46934193	missense	probably damaging	1.00
IGL02387:Ubr2	APN	17	46963150	missense	probably benign
IGL02696:Ubr2	APN	17	46963765	missense	probably benign
IGL02726:Ubr2	APN	17	46972921	missense	probably damaging	1.00
IGL02750:Ubr2	APN	17	46969282	missense	probably benign	0.00
IGL02934:Ubr2	APN	17	46957340	missense	possibly damaging	0.50
IGL02959:Ubr2	APN	17	46975951	missense	probably damaging	0.96
IGL03018:Ubr2	APN	17	46954046	missense	possibly damaging	0.64
IGL03343:Ubr2	APN	17	46951918	missense	probably benign	0.00
PIT4280001:Ubr2	UTSW	17	46944863	missense	probably damaging	1.00
R0044:Ubr2	UTSW	17	46992985	splice site	probably benign
R0044:Ubr2	UTSW	17	46992985	splice site	probably benign
R0446:Ubr2	UTSW	17	46983298	missense	probably damaging	1.00
R0513:Ubr2	UTSW	17	46986779	nonsense	probably null
R0565:Ubr2	UTSW	17	46955886	missense	probably damaging	1.00
R0600:Ubr2	UTSW	17	46967248	missense	probably damaging	0.99
R0690:Ubr2	UTSW	17	46938653	missense	probably damaging	0.97
R0710:Ubr2	UTSW	17	46938681	missense	probably damaging	0.96
R0761:Ubr2	UTSW	17	46983316	missense	probably damaging	1.00
R0798:Ubr2	UTSW	17	46969176	splice site	probably benign
R0862:Ubr2	UTSW	17	46967083	nonsense	probably null
R0947:Ubr2	UTSW	17	46941112	missense	probably damaging	0.99
R0972:Ubr2	UTSW	17	46934261	splice site	probably null
R1500:Ubr2	UTSW	17	46986689	missense	possibly damaging	0.79
R1514:Ubr2	UTSW	17	47000823	missense	probably damaging	1.00
R1533:Ubr2	UTSW	17	46967247	nonsense	probably null
R1554:Ubr2	UTSW	17	46972951	missense	probably benign
R1575:Ubr2	UTSW	17	46932492	missense	probably damaging	1.00
R1602:Ubr2	UTSW	17	46941061	missense	probably benign	0.30
R1941:Ubr2	UTSW	17	46974026	missense	probably damaging	1.00
R1966:Ubr2	UTSW	17	46954919	missense	probably benign	0.05
R2041:Ubr2	UTSW	17	46986047	missense	probably damaging	1.00
R2067:Ubr2	UTSW	17	46963145	critical splice donor site	probably null
R2111:Ubr2	UTSW	17	46963145	critical splice donor site	probably null
R2189:Ubr2	UTSW	17	46943364	missense	probably benign	0.01
R2219:Ubr2	UTSW	17	46986042	missense	possibly damaging	0.94
R2307:Ubr2	UTSW	17	46966215	nonsense	probably null
R3426:Ubr2	UTSW	17	46968439	missense	probably damaging	1.00
R3428:Ubr2	UTSW	17	46968439	missense	probably damaging	1.00
R3608:Ubr2	UTSW	17	46944523	missense	probably damaging	1.00
R4080:Ubr2	UTSW	17	46988722	missense	probably benign	0.05
R4330:Ubr2	UTSW	17	46967278	missense	probably null	1.00
R4383:Ubr2	UTSW	17	46939387	missense	probably benign	0.01
R4460:Ubr2	UTSW	17	46945045	critical splice donor site	probably null
R4794:Ubr2	UTSW	17	46930445	missense	probably damaging	1.00
R4902:Ubr2	UTSW	17	46985996	missense	possibly damaging	0.91
R4913:Ubr2	UTSW	17	46959459	splice site	probably null
R5092:Ubr2	UTSW	17	46969247	missense	probably damaging	1.00
R5209:Ubr2	UTSW	17	46968424	missense	probably damaging	1.00
R5226:Ubr2	UTSW	17	46983270	missense	probably benign	0.04
R5250:Ubr2	UTSW	17	46930442	missense	probably benign	0.01
R5437:Ubr2	UTSW	17	46963697	missense	probably benign	0.00
R5607:Ubr2	UTSW	17	46934200	nonsense	probably null
R5848:Ubr2	UTSW	17	46956655	missense	possibly damaging	0.84
R6089:Ubr2	UTSW	17	46982292	missense	possibly damaging	0.95
R6382:Ubr2	UTSW	17	46957315	missense	possibly damaging	0.56
R6552:Ubr2	UTSW	17	46966268	splice site	probably null
R6630:Ubr2	UTSW	17	46951984	missense	possibly damaging	0.51
R6892:Ubr2	UTSW	17	46934108	missense	probably damaging	0.99
R6936:Ubr2	UTSW	17	46973031	missense	possibly damaging	0.94
R7039:Ubr2	UTSW	17	47010213	missense	probably benign	0.01
R7050:Ubr2	UTSW	17	46961602	missense	probably benign	0.30
R7078:Ubr2	UTSW	17	46955853	missense	possibly damaging	0.59
R7126:Ubr2	UTSW	17	46974056	splice site	probably null
R7219:Ubr2	UTSW	17	46935434	nonsense	probably null
R7262:Ubr2	UTSW	17	47000739	missense	probably damaging	0.97
R7352:Ubr2	UTSW	17	46930426	missense	probably benign	0.19
R7449:Ubr2	UTSW	17	46964788	missense	probably damaging	1.00
R7496:Ubr2	UTSW	17	46990991	critical splice donor site	probably null
R7759:Ubr2	UTSW	17	46986048	missense	probably damaging	1.00
R7869:Ubr2	UTSW	17	46991008	missense	probably benign	0.00
R7916:Ubr2	UTSW	17	46968382	critical splice donor site	probably null
R8236:Ubr2	UTSW	17	46951909	missense	probably benign
R8376:Ubr2	UTSW	17	46942795	missense	probably benign	0.07
R9026:Ubr2	UTSW	17	46934115	missense	probably damaging	1.00
R9216:Ubr2	UTSW	17	46981359	missense	probably benign	0.36
R9339:Ubr2	UTSW	17	46973939	missense	probably benign	0.30
R9558:Ubr2	UTSW	17	46951917	missense	probably benign
R9606:Ubr2	UTSW	17	46934094	missense	probably damaging	1.00
R9644:Ubr2	UTSW	17	46955780	critical splice donor site	probably null
R9731:Ubr2	UTSW	17	46963145	critical splice donor site	probably null
X0027:Ubr2	UTSW	17	47000629	missense	probably damaging	0.99
X0061:Ubr2	UTSW	17	46970111	missense	possibly damaging	0.88
Z1177:Ubr2	UTSW	17	46959509	missense	probably benign
Z1177:Ubr2	UTSW	17	47000766	missense	possibly damaging	0.76
Z1177:Ubr2	UTSW	17	47010143	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- GCAGAAATGCTAAGGGCTATGC -3'
(R):5'- GGCTCATTCAGTATTACAGTCATAACC -3'

Sequencing Primer
(F):5'- GGCTGGCTTTGAACTCTCAGC -3'
(R):5'- ACAGTCATAACCTTTGTATTGCAGCC -3'

Posted On

2019-09-13