Incidental Mutation 'R7366:Rbp4'
ID571849
Institutional Source Beutler Lab
Gene Symbol Rbp4
Ensembl Gene ENSMUSG00000024990
Gene Nameretinol binding protein 4, plasma
Synonymsretinol binding protein 4, cellular, Rbp-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7366 (G1)
Quality Score132.008
Status Validated
Chromosome19
Chromosomal Location38116620-38125321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 38124962 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 36 (R36H)
Ref Sequence ENSEMBL: ENSMUSP00000025951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025951] [ENSMUST00000112335]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025951
AA Change: R36H

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025951
Gene: ENSMUSG00000024990
AA Change: R36H

DomainStartEndE-ValueType
low complexity region 47 60 N/A INTRINSIC
Pfam:Lipocalin_2 77 229 8.2e-9 PFAM
Pfam:Lipocalin 83 229 8.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112335
SMART Domains Protein: ENSMUSP00000107954
Gene: ENSMUSG00000024990

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Lipocalin_2 33 186 3.6e-9 PFAM
Pfam:Lipocalin 39 185 6.5e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.1%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the lipocalin family and is the specific carrier for retinol (vitamin A alcohol) in the blood. It delivers retinol from the liver stores to the peripheral tissues. In plasma, the RBP-retinol complex interacts with transthyretin which prevents its loss by filtration through the kidney glomeruli. A deficiency of vitamin A blocks secretion of the binding protein posttranslationally and results in defective delivery and supply to the epidermal cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show abnormal retinal function and retinol level, delayed heart trabeculation, and increased myocyte proliferation and fibronectin deposition in cardiac jelly and nascent valves. Homozygotes for another null allele show testicular defects on a vitamin A-deficient diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,208,118 probably null Het
1700030K09Rik C T 8: 72,449,459 P244S possibly damaging Het
4930404N11Rik T C 10: 81,364,191 D165G possibly damaging Het
4930562C15Rik A G 16: 4,835,769 I61V unknown Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Acbd3 A G 1: 180,734,499 E181G probably benign Het
Ano3 T C 2: 110,757,067 Y43C probably damaging Het
Aspa T A 11: 73,319,890 probably null Het
AU018091 A T 7: 3,156,330 N620K probably damaging Het
Bicc1 G T 10: 70,943,386 T724K probably benign Het
Bmper T C 9: 23,484,004 I677T probably damaging Het
C3 T A 17: 57,221,162 T686S probably benign Het
Cc2d2a G T 5: 43,729,990 R1315L probably damaging Het
Ccdc150 G T 1: 54,300,382 E462* probably null Het
Ccdc88c C A 12: 100,944,950 R875L possibly damaging Het
Cd177 C T 7: 24,756,722 G207D probably damaging Het
Cdh23 A T 10: 60,315,692 Y2471* probably null Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cmbl A T 15: 31,589,856 Y244F probably benign Het
Dcaf10 T C 4: 45,373,919 V448A probably damaging Het
Ddr2 A G 1: 169,997,964 W356R probably damaging Het
Depdc1a A G 3: 159,523,212 I534V probably benign Het
Dhtkd1 T A 2: 5,917,906 I481L probably benign Het
Dlst A T 12: 85,128,315 I260L probably benign Het
Dnajc13 T G 9: 104,184,706 K1350Q probably benign Het
Dpp4 T C 2: 62,354,599 Y520C probably damaging Het
Dr1 C A 5: 108,275,728 A127E unknown Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
E130308A19Rik T C 4: 59,752,770 C628R probably damaging Het
Edem3 T A 1: 151,812,614 probably null Het
Fam20a T A 11: 109,673,342 Q528H possibly damaging Het
Fanca T C 8: 123,281,213 E981G probably benign Het
Fbp2 A G 13: 62,837,198 V303A possibly damaging Het
Flii C T 11: 60,721,119 V353M possibly damaging Het
Gm10277 T A 11: 77,785,758 Y129F unknown Het
Gm3159 A T 14: 4,398,525 H72L probably benign Het
Gm5114 T G 7: 39,409,344 T284P possibly damaging Het
Gm7168 T C 17: 13,949,885 S505P probably damaging Het
Gnal T C 18: 67,211,071 V239A possibly damaging Het
Gtf2i C T 5: 134,265,749 E370K probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Il3 T A 11: 54,265,883 R93S probably benign Het
Itsn1 A G 16: 91,908,450 E1573G unknown Het
Kif26a G A 12: 112,163,542 probably null Het
Klb T C 5: 65,372,431 M434T probably damaging Het
Lrp2 T A 2: 69,483,806 R2194W probably damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Mak16 A G 8: 31,166,099 Y119H possibly damaging Het
Map3k19 T A 1: 127,817,455 M1421L probably damaging Het
Mbd5 A G 2: 49,274,568 I1186V probably benign Het
Mboat1 T A 13: 30,202,362 C120S possibly damaging Het
Mctp2 T A 7: 72,259,214 D117V probably benign Het
Mocos C A 18: 24,676,616 N425K probably damaging Het
Nav2 A G 7: 49,554,203 probably null Het
Ngfr A T 11: 95,574,429 W198R possibly damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Obsl1 T C 1: 75,502,964 S596G probably damaging Het
Olfr111 T A 17: 37,530,817 V280D probably damaging Het
Olfr1414 A G 1: 92,511,678 S117P possibly damaging Het
Olfr578 A T 7: 102,984,516 I216K probably damaging Het
Olfr594 T G 7: 103,220,533 Y272D probably benign Het
Olfr705 G T 7: 106,873,396 P283Q probably damaging Het
Pithd1 T C 4: 135,987,050 Y29C probably benign Het
Plcb3 T C 19: 6,962,021 T530A probably benign Het
Prss40 A T 1: 34,559,871 Y70* probably null Het
Ralgps1 T C 2: 33,324,688 M61V possibly damaging Het
Rnf125 A G 18: 20,974,433 N7S not run Het
Rpe65 G A 3: 159,624,729 S511N probably benign Het
Rspo4 A T 2: 151,867,873 Y66F probably damaging Het
Ruvbl2 A G 7: 45,422,149 S437P probably benign Het
Sele C A 1: 164,048,719 R12S probably benign Het
Sgo2b T A 8: 63,938,417 K139* probably null Het
Shroom3 C A 5: 92,964,606 S1942* probably null Het
Slc12a9 G A 5: 137,328,623 R191* probably null Het
Spag9 G T 11: 94,108,521 V1088L possibly damaging Het
Sptb T G 12: 76,604,194 D1669A probably damaging Het
Sptlc2 A G 12: 87,314,049 probably null Het
Sult2a8 A T 7: 14,416,329 probably null Het
Synpo2 A G 3: 123,114,041 V542A probably damaging Het
Tecpr2 T C 12: 110,915,480 probably null Het
Tenm2 T C 11: 36,069,414 T1029A probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tnfaip8l1 C A 17: 56,171,897 N62K probably damaging Het
Tollip A G 7: 141,889,597 S174P probably benign Het
Trp53tg5 A G 2: 164,471,107 I216T possibly damaging Het
Tssk5 A G 15: 76,374,513 S58P probably benign Het
Ttc9b T C 7: 27,654,959 Y157H probably damaging Het
Tuba8 A G 6: 121,222,912 Y185C probably damaging Het
Ubr2 C T 17: 46,955,845 A1127T probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Yipf3 T A 17: 46,248,929 L57Q possibly damaging Het
Zbtb32 A C 7: 30,590,181 C19G probably damaging Het
Zfp735 A T 11: 73,712,153 H641L possibly damaging Het
Zfyve28 A T 5: 34,232,227 Y210N probably damaging Het
Zpr1 T A 9: 46,273,373 probably null Het
Other mutations in Rbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01727:Rbp4 APN 19 38124052 missense probably benign 0.00
IGL01868:Rbp4 APN 19 38124520 missense probably damaging 0.98
IGL02326:Rbp4 APN 19 38124115 missense probably damaging 0.96
IGL02828:Rbp4 APN 19 38118269 splice site probably null
R0666:Rbp4 UTSW 19 38118460 missense probably damaging 1.00
R2422:Rbp4 UTSW 19 38124344 missense probably damaging 0.96
R6253:Rbp4 UTSW 19 38124980 missense probably benign 0.05
R7075:Rbp4 UTSW 19 38124061 missense probably damaging 1.00
R7204:Rbp4 UTSW 19 38124103 missense possibly damaging 0.88
R7863:Rbp4 UTSW 19 38124098 missense possibly damaging 0.49
R7946:Rbp4 UTSW 19 38124098 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TCTCCTTGACTCGGAAGCTG -3'
(R):5'- TTTTCGCTCAGTGAGGCCAC -3'

Sequencing Primer
(F):5'- TTGACTCGGAAGCTGCTCAC -3'
(R):5'- ACACCATGGCCACGTAGG -3'
Posted On2019-09-13