Mutagenetix > Incidental Mutation

Incidental Mutation 'R7367:Dsel'

571853

Institutional Source

Beutler Lab

Gene Symbol

Dsel

Ensembl Gene

ENSMUSG00000038702

Gene Name

dermatan sulfate epimerase-like

Synonyms

9330132E09Rik, DS-epi2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R7367 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

111858702-111864918 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 111861573 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 411 (G411S)

Ref Sequence

ENSEMBL: ENSMUSP00000043570 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035462]

AlphaFold

Q0VBN2

Predicted Effect

probably damaging
Transcript: ENSMUST00000035462
AA Change: G411S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043570
Gene: ENSMUSG00000038702
AA Change: G411S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	120	131	N/A	INTRINSIC
low complexity region	568	577	N/A	INTRINSIC
transmembrane domain	769	791	N/A	INTRINSIC
transmembrane domain	798	817	N/A	INTRINSIC
Pfam:Sulfotransfer_1	847	1201	2.1e-12	PFAM
Pfam:Sulfotransfer_3	848	1143	1.7e-11	PFAM

Meta Mutation Damage Score

0.5608

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced epimerase activity in the skin, lung, liver, spleen, kidney and brain and reduced iduronic acid content in the brain and kidney chondroitin sulfate/dermatan sulfate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adh1	A	G	3: 138,290,551	T374A	probably benign	Het
Agps	T	A	2: 75,868,313	H348Q	possibly damaging	Het
Als2cr12	A	T	1: 58,666,864	I282N	probably benign	Het
Ankrd34b	C	A	13: 92,438,287	T9K	probably benign	Het
Atp10b	A	G	11: 43,247,501	Q1203R	probably damaging	Het
B4galnt4	A	G	7: 141,064,475	N123D	probably damaging	Het
C530008M17Rik	T	A	5: 76,856,602	L270Q	unknown	Het
Cep250	A	G	2: 155,969,307	T358A	probably benign	Het
Cfh	A	T	1: 140,086,521	H1188Q	probably damaging	Het
Cisd1	A	G	10: 71,336,360	Y31H	probably damaging	Het
Cnga1	G	A	5: 72,605,358	S271F	possibly damaging	Het
Cntnap5a	A	G	1: 116,442,295	T881A	probably benign	Het
Cyp2s1	A	T	7: 25,805,973	D355E	possibly damaging	Het
Dnah11	T	A	12: 117,987,442	R3044W	possibly damaging	Het
Dnah17	T	C	11: 118,115,196	D730G	probably benign	Het
Epha7	C	T	4: 28,871,937	S422L	probably benign	Het
Fsd2	A	G	7: 81,535,180	I656T	probably damaging	Het
Gm40460	GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG	GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG	7: 142,240,434		probably benign	Het
Gm45871	A	T	18: 90,591,100	H154L	probably benign	Het
Golgb1	T	A	16: 36,898,546	N312K	probably benign	Het
Hist1h2ab	A	G	13: 23,751,350	D73G	possibly damaging	Het
Hsd17b4	T	A	18: 50,155,185	H227Q	probably damaging	Het
Hsd17b6	A	T	10: 127,993,623	S237T	probably benign	Het
Htra4	A	T	8: 25,033,697	V284E	probably damaging	Het
Kcnv1	C	T	15: 45,109,242	C415Y	probably damaging	Het
Kif11	T	A	19: 37,420,341	L1037H	probably benign	Het
Lama5	T	C	2: 180,192,958	T1347A	probably benign	Het
Lrrc32	G	T	7: 98,498,879	E289*	probably null	Het
Lrrc66	T	C	5: 73,608,381	T440A	probably benign	Het
Neurl4	T	C	11: 69,908,582	L928P	probably damaging	Het
Nos2	G	A	11: 78,950,090	C788Y	possibly damaging	Het
Olfr1030	T	C	2: 85,984,343	W168R	possibly damaging	Het
Olfr1265	A	G	2: 90,037,812	S298G	probably benign	Het
Olfr15	A	G	16: 3,839,302	T110A	probably damaging	Het
Pafah1b3	A	G	7: 25,296,066	C156R	probably benign	Het
Pak1ip1	T	G	13: 41,008,895	N151K	probably damaging	Het
Pax7	G	A	4: 139,779,749	P326S	probably benign	Het
Pex11b	G	A	3: 96,636,678	A21T	probably damaging	Het
Pkn2	A	G	3: 142,810,727	V546A	probably benign	Het
Ppat	T	A	5: 76,919,864	R260*	probably null	Het
Ppp1r13l	C	G	7: 19,370,156	S187R	probably benign	Het
Pwp2	C	T	10: 78,182,480	G126R	probably damaging	Het
R3hdm1	A	G	1: 128,153,392	D55G	possibly damaging	Het
Rev1	A	T	1: 38,074,407	Y526*	probably null	Het
Rp1	A	G	1: 4,347,998	W964R	probably benign	Het
Sarnp	A	G	10: 128,833,378	I35V	probably damaging	Het
Sec23a	T	C	12: 58,966,999	N730S	probably benign	Het
Sh3d19	A	G	3: 86,104,228	K374E	probably benign	Het
Sh3tc2	A	G	18: 61,989,506	D446G	probably benign	Het
Sugct	T	A	13: 17,644,814	I149F	probably damaging	Het
Tle2	A	G	10: 81,580,318	N142S	probably damaging	Het
Tpsg1	G	T	17: 25,373,210	G86V	probably damaging	Het
Trpm1	T	A	7: 64,268,801	Y1514N	probably benign	Het
Ubr4	C	T	4: 139,452,691	S259L	unknown	Het
Utp20	A	T	10: 88,795,443	L892Q	probably benign	Het
Wdr92	A	G	11: 17,232,712	Y291C	probably damaging	Het
Wisp3	A	G	10: 39,158,265	C114R	probably damaging	Het
Zfp956	C	T	6: 47,963,919	T404M	probably damaging	Het

Other mutations in Dsel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01114:Dsel	APN	1	111860061	nonsense	probably null
IGL01562:Dsel	APN	1	111860319	missense	probably benign
IGL01591:Dsel	APN	1	111859695	missense	probably benign	0.08
IGL01822:Dsel	APN	1	111861896	missense	probably damaging	1.00
IGL02289:Dsel	APN	1	111860102	nonsense	probably null
IGL02557:Dsel	APN	1	111862570	missense	probably damaging	1.00
IGL02805:Dsel	APN	1	111862316	missense	probably damaging	1.00
IGL02864:Dsel	APN	1	111859214	missense	probably damaging	1.00
IGL02887:Dsel	APN	1	111860732	missense	possibly damaging	0.90
IGL03092:Dsel	APN	1	111860063	missense	probably damaging	1.00
IGL03117:Dsel	APN	1	111859178	utr 3 prime	probably benign
IGL03182:Dsel	APN	1	111860138	missense	probably damaging	0.99
rudolph	UTSW	1	111859817	missense	probably damaging	0.99
R0196:Dsel	UTSW	1	111861603	missense	possibly damaging	0.86
R0465:Dsel	UTSW	1	111862262	missense	probably benign	0.00
R0725:Dsel	UTSW	1	111859952	missense	possibly damaging	0.79
R1024:Dsel	UTSW	1	111860673	missense	probably damaging	1.00
R1147:Dsel	UTSW	1	111862209	missense	possibly damaging	0.71
R1147:Dsel	UTSW	1	111862209	missense	possibly damaging	0.71
R1654:Dsel	UTSW	1	111862512	missense	probably damaging	1.00
R1728:Dsel	UTSW	1	111859457	missense	probably benign
R1728:Dsel	UTSW	1	111859994	missense	probably benign
R1729:Dsel	UTSW	1	111859457	missense	probably benign
R1729:Dsel	UTSW	1	111859994	missense	probably benign
R1730:Dsel	UTSW	1	111859457	missense	probably benign
R1730:Dsel	UTSW	1	111859994	missense	probably benign
R1735:Dsel	UTSW	1	111860915	missense	probably damaging	1.00
R1739:Dsel	UTSW	1	111859457	missense	probably benign
R1739:Dsel	UTSW	1	111859994	missense	probably benign
R1762:Dsel	UTSW	1	111859457	missense	probably benign
R1762:Dsel	UTSW	1	111859994	missense	probably benign
R1783:Dsel	UTSW	1	111859457	missense	probably benign
R1783:Dsel	UTSW	1	111859994	missense	probably benign
R1785:Dsel	UTSW	1	111859457	missense	probably benign
R1785:Dsel	UTSW	1	111859994	missense	probably benign
R2049:Dsel	UTSW	1	111859457	missense	probably benign
R2080:Dsel	UTSW	1	111859962	missense	probably benign
R2141:Dsel	UTSW	1	111859457	missense	probably benign
R2142:Dsel	UTSW	1	111859457	missense	probably benign
R2150:Dsel	UTSW	1	111860257	missense	probably benign	0.04
R4324:Dsel	UTSW	1	111861393	missense	probably damaging	1.00
R5378:Dsel	UTSW	1	111862821	start gained	probably benign
R5881:Dsel	UTSW	1	111859438	missense	probably damaging	1.00
R5919:Dsel	UTSW	1	111860253	missense	probably benign
R6820:Dsel	UTSW	1	111859817	missense	probably damaging	0.99
R7003:Dsel	UTSW	1	111860295	missense	probably benign
R7064:Dsel	UTSW	1	111862847	start gained	probably benign
R7297:Dsel	UTSW	1	111861776	missense	probably damaging	1.00
R7340:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7341:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7343:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7346:Dsel	UTSW	1	111861068	missense	probably damaging	1.00
R7347:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7365:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7366:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7393:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7974:Dsel	UTSW	1	111860499	missense	probably benign	0.00
R7978:Dsel	UTSW	1	111859719	nonsense	probably null
R8220:Dsel	UTSW	1	111861707	missense	probably damaging	1.00
R8434:Dsel	UTSW	1	111861655	missense	probably damaging	1.00
R8688:Dsel	UTSW	1	111862738	nonsense	probably null
R8819:Dsel	UTSW	1	111860264	missense	probably benign	0.11
R8820:Dsel	UTSW	1	111860264	missense	probably benign	0.11
R8923:Dsel	UTSW	1	111860554	missense	possibly damaging	0.85
R9014:Dsel	UTSW	1	111860779	nonsense	probably null
R9196:Dsel	UTSW	1	111860133	missense	probably benign	0.01
R9384:Dsel	UTSW	1	111860133	nonsense	probably null
R9427:Dsel	UTSW	1	111859695	missense	probably damaging	0.99
X0057:Dsel	UTSW	1	111859210	missense	probably benign
Z1177:Dsel	UTSW	1	111861716	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGCCTCAGAAACGAATACCTG -3'
(R):5'- GCTGGAAATTGGTTAGCTCAG -3'

Sequencing Primer
(F):5'- GAATACCTGCCCATTAGGAGCG -3'
(R):5'- TGGTTAGCTCAGCAAATTAGAAAGC -3'

Posted On

2019-09-13