Incidental Mutation 'R7367:Dsel'
ID 571853
Institutional Source Beutler Lab
Gene Symbol Dsel
Ensembl Gene ENSMUSG00000038702
Gene Name dermatan sulfate epimerase-like
Synonyms 9330132E09Rik, DS-epi2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock # R7367 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 111858702-111864918 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 111861573 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 411 (G411S)
Ref Sequence ENSEMBL: ENSMUSP00000043570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035462]
AlphaFold Q0VBN2
Predicted Effect probably damaging
Transcript: ENSMUST00000035462
AA Change: G411S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043570
Gene: ENSMUSG00000038702
AA Change: G411S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 120 131 N/A INTRINSIC
low complexity region 568 577 N/A INTRINSIC
transmembrane domain 769 791 N/A INTRINSIC
transmembrane domain 798 817 N/A INTRINSIC
Pfam:Sulfotransfer_1 847 1201 2.1e-12 PFAM
Pfam:Sulfotransfer_3 848 1143 1.7e-11 PFAM
Meta Mutation Damage Score 0.5608 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced epimerase activity in the skin, lung, liver, spleen, kidney and brain and reduced iduronic acid content in the brain and kidney chondroitin sulfate/dermatan sulfate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 A G 3: 138,290,551 T374A probably benign Het
Agps T A 2: 75,868,313 H348Q possibly damaging Het
Als2cr12 A T 1: 58,666,864 I282N probably benign Het
Ankrd34b C A 13: 92,438,287 T9K probably benign Het
Atp10b A G 11: 43,247,501 Q1203R probably damaging Het
B4galnt4 A G 7: 141,064,475 N123D probably damaging Het
C530008M17Rik T A 5: 76,856,602 L270Q unknown Het
Cep250 A G 2: 155,969,307 T358A probably benign Het
Cfh A T 1: 140,086,521 H1188Q probably damaging Het
Cisd1 A G 10: 71,336,360 Y31H probably damaging Het
Cnga1 G A 5: 72,605,358 S271F possibly damaging Het
Cntnap5a A G 1: 116,442,295 T881A probably benign Het
Cyp2s1 A T 7: 25,805,973 D355E possibly damaging Het
Dnah11 T A 12: 117,987,442 R3044W possibly damaging Het
Dnah17 T C 11: 118,115,196 D730G probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fsd2 A G 7: 81,535,180 I656T probably damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gm45871 A T 18: 90,591,100 H154L probably benign Het
Golgb1 T A 16: 36,898,546 N312K probably benign Het
Hist1h2ab A G 13: 23,751,350 D73G possibly damaging Het
Hsd17b4 T A 18: 50,155,185 H227Q probably damaging Het
Hsd17b6 A T 10: 127,993,623 S237T probably benign Het
Htra4 A T 8: 25,033,697 V284E probably damaging Het
Kcnv1 C T 15: 45,109,242 C415Y probably damaging Het
Kif11 T A 19: 37,420,341 L1037H probably benign Het
Lama5 T C 2: 180,192,958 T1347A probably benign Het
Lrrc32 G T 7: 98,498,879 E289* probably null Het
Lrrc66 T C 5: 73,608,381 T440A probably benign Het
Neurl4 T C 11: 69,908,582 L928P probably damaging Het
Nos2 G A 11: 78,950,090 C788Y possibly damaging Het
Olfr1030 T C 2: 85,984,343 W168R possibly damaging Het
Olfr1265 A G 2: 90,037,812 S298G probably benign Het
Olfr15 A G 16: 3,839,302 T110A probably damaging Het
Pafah1b3 A G 7: 25,296,066 C156R probably benign Het
Pak1ip1 T G 13: 41,008,895 N151K probably damaging Het
Pax7 G A 4: 139,779,749 P326S probably benign Het
Pex11b G A 3: 96,636,678 A21T probably damaging Het
Pkn2 A G 3: 142,810,727 V546A probably benign Het
Ppat T A 5: 76,919,864 R260* probably null Het
Ppp1r13l C G 7: 19,370,156 S187R probably benign Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
R3hdm1 A G 1: 128,153,392 D55G possibly damaging Het
Rev1 A T 1: 38,074,407 Y526* probably null Het
Rp1 A G 1: 4,347,998 W964R probably benign Het
Sarnp A G 10: 128,833,378 I35V probably damaging Het
Sec23a T C 12: 58,966,999 N730S probably benign Het
Sh3d19 A G 3: 86,104,228 K374E probably benign Het
Sh3tc2 A G 18: 61,989,506 D446G probably benign Het
Sugct T A 13: 17,644,814 I149F probably damaging Het
Tle2 A G 10: 81,580,318 N142S probably damaging Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Trpm1 T A 7: 64,268,801 Y1514N probably benign Het
Ubr4 C T 4: 139,452,691 S259L unknown Het
Utp20 A T 10: 88,795,443 L892Q probably benign Het
Wdr92 A G 11: 17,232,712 Y291C probably damaging Het
Wisp3 A G 10: 39,158,265 C114R probably damaging Het
Zfp956 C T 6: 47,963,919 T404M probably damaging Het
Other mutations in Dsel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Dsel APN 1 111860061 nonsense probably null
IGL01562:Dsel APN 1 111860319 missense probably benign
IGL01591:Dsel APN 1 111859695 missense probably benign 0.08
IGL01822:Dsel APN 1 111861896 missense probably damaging 1.00
IGL02289:Dsel APN 1 111860102 nonsense probably null
IGL02557:Dsel APN 1 111862570 missense probably damaging 1.00
IGL02805:Dsel APN 1 111862316 missense probably damaging 1.00
IGL02864:Dsel APN 1 111859214 missense probably damaging 1.00
IGL02887:Dsel APN 1 111860732 missense possibly damaging 0.90
IGL03092:Dsel APN 1 111860063 missense probably damaging 1.00
IGL03117:Dsel APN 1 111859178 utr 3 prime probably benign
IGL03182:Dsel APN 1 111860138 missense probably damaging 0.99
rudolph UTSW 1 111859817 missense probably damaging 0.99
R0196:Dsel UTSW 1 111861603 missense possibly damaging 0.86
R0465:Dsel UTSW 1 111862262 missense probably benign 0.00
R0725:Dsel UTSW 1 111859952 missense possibly damaging 0.79
R1024:Dsel UTSW 1 111860673 missense probably damaging 1.00
R1147:Dsel UTSW 1 111862209 missense possibly damaging 0.71
R1147:Dsel UTSW 1 111862209 missense possibly damaging 0.71
R1654:Dsel UTSW 1 111862512 missense probably damaging 1.00
R1728:Dsel UTSW 1 111859457 missense probably benign
R1728:Dsel UTSW 1 111859994 missense probably benign
R1729:Dsel UTSW 1 111859457 missense probably benign
R1729:Dsel UTSW 1 111859994 missense probably benign
R1730:Dsel UTSW 1 111859457 missense probably benign
R1730:Dsel UTSW 1 111859994 missense probably benign
R1735:Dsel UTSW 1 111860915 missense probably damaging 1.00
R1739:Dsel UTSW 1 111859457 missense probably benign
R1739:Dsel UTSW 1 111859994 missense probably benign
R1762:Dsel UTSW 1 111859457 missense probably benign
R1762:Dsel UTSW 1 111859994 missense probably benign
R1783:Dsel UTSW 1 111859457 missense probably benign
R1783:Dsel UTSW 1 111859994 missense probably benign
R1785:Dsel UTSW 1 111859457 missense probably benign
R1785:Dsel UTSW 1 111859994 missense probably benign
R2049:Dsel UTSW 1 111859457 missense probably benign
R2080:Dsel UTSW 1 111859962 missense probably benign
R2141:Dsel UTSW 1 111859457 missense probably benign
R2142:Dsel UTSW 1 111859457 missense probably benign
R2150:Dsel UTSW 1 111860257 missense probably benign 0.04
R4324:Dsel UTSW 1 111861393 missense probably damaging 1.00
R5378:Dsel UTSW 1 111862821 start gained probably benign
R5881:Dsel UTSW 1 111859438 missense probably damaging 1.00
R5919:Dsel UTSW 1 111860253 missense probably benign
R6820:Dsel UTSW 1 111859817 missense probably damaging 0.99
R7003:Dsel UTSW 1 111860295 missense probably benign
R7064:Dsel UTSW 1 111862847 start gained probably benign
R7297:Dsel UTSW 1 111861776 missense probably damaging 1.00
R7340:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7341:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7343:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7346:Dsel UTSW 1 111861068 missense probably damaging 1.00
R7347:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7365:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7366:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7393:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7974:Dsel UTSW 1 111860499 missense probably benign 0.00
R7978:Dsel UTSW 1 111859719 nonsense probably null
R8220:Dsel UTSW 1 111861707 missense probably damaging 1.00
R8434:Dsel UTSW 1 111861655 missense probably damaging 1.00
R8688:Dsel UTSW 1 111862738 nonsense probably null
R8819:Dsel UTSW 1 111860264 missense probably benign 0.11
R8820:Dsel UTSW 1 111860264 missense probably benign 0.11
R8923:Dsel UTSW 1 111860554 missense possibly damaging 0.85
R9014:Dsel UTSW 1 111860779 nonsense probably null
R9196:Dsel UTSW 1 111860133 missense probably benign 0.01
R9384:Dsel UTSW 1 111860133 nonsense probably null
R9427:Dsel UTSW 1 111859695 missense probably damaging 0.99
X0057:Dsel UTSW 1 111859210 missense probably benign
Z1177:Dsel UTSW 1 111861716 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCCTCAGAAACGAATACCTG -3'
(R):5'- GCTGGAAATTGGTTAGCTCAG -3'

Sequencing Primer
(F):5'- GAATACCTGCCCATTAGGAGCG -3'
(R):5'- TGGTTAGCTCAGCAAATTAGAAAGC -3'
Posted On 2019-09-13