Incidental Mutation 'R7367:Olfr1030'
ID571858
Institutional Source Beutler Lab
Gene Symbol Olfr1030
Ensembl Gene ENSMUSG00000044923
Gene Nameolfactory receptor 1030
SynonymsGA_x6K02T2Q125-47462755-47463693, MOR196-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R7367 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location85979276-85988294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85984343 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 168 (W168R)
Ref Sequence ENSEMBL: ENSMUSP00000053309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056849]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056849
AA Change: W168R

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000053309
Gene: ENSMUSG00000044923
AA Change: W168R

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 2.4e-58 PFAM
Pfam:7tm_1 47 296 3.2e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 A G 3: 138,290,551 T374A probably benign Het
Agps T A 2: 75,868,313 H348Q possibly damaging Het
Als2cr12 A T 1: 58,666,864 I282N probably benign Het
Ankrd34b C A 13: 92,438,287 T9K probably benign Het
Atp10b A G 11: 43,247,501 Q1203R probably damaging Het
B4galnt4 A G 7: 141,064,475 N123D probably damaging Het
C530008M17Rik T A 5: 76,856,602 L270Q unknown Het
Cep250 A G 2: 155,969,307 T358A probably benign Het
Cfh A T 1: 140,086,521 H1188Q probably damaging Het
Cisd1 A G 10: 71,336,360 Y31H probably damaging Het
Cnga1 G A 5: 72,605,358 S271F possibly damaging Het
Cntnap5a A G 1: 116,442,295 T881A probably benign Het
Cyp2s1 A T 7: 25,805,973 D355E possibly damaging Het
Dnah11 T A 12: 117,987,442 R3044W possibly damaging Het
Dnah17 T C 11: 118,115,196 D730G probably benign Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fsd2 A G 7: 81,535,180 I656T probably damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gm45871 A T 18: 90,591,100 H154L probably benign Het
Golgb1 T A 16: 36,898,546 N312K probably benign Het
Hist1h2ab A G 13: 23,751,350 D73G possibly damaging Het
Hsd17b4 T A 18: 50,155,185 H227Q probably damaging Het
Hsd17b6 A T 10: 127,993,623 S237T probably benign Het
Htra4 A T 8: 25,033,697 V284E probably damaging Het
Kcnv1 C T 15: 45,109,242 C415Y probably damaging Het
Kif11 T A 19: 37,420,341 L1037H probably benign Het
Lama5 T C 2: 180,192,958 T1347A probably benign Het
Lrrc32 G T 7: 98,498,879 E289* probably null Het
Lrrc66 T C 5: 73,608,381 T440A probably benign Het
Neurl4 T C 11: 69,908,582 L928P probably damaging Het
Nos2 G A 11: 78,950,090 C788Y possibly damaging Het
Olfr1265 A G 2: 90,037,812 S298G probably benign Het
Olfr15 A G 16: 3,839,302 T110A probably damaging Het
Pafah1b3 A G 7: 25,296,066 C156R probably benign Het
Pak1ip1 T G 13: 41,008,895 N151K probably damaging Het
Pax7 G A 4: 139,779,749 P326S probably benign Het
Pex11b G A 3: 96,636,678 A21T probably damaging Het
Pkn2 A G 3: 142,810,727 V546A probably benign Het
Ppat T A 5: 76,919,864 R260* probably null Het
Ppp1r13l C G 7: 19,370,156 S187R probably benign Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
R3hdm1 A G 1: 128,153,392 D55G possibly damaging Het
Rev1 A T 1: 38,074,407 Y526* probably null Het
Rp1 A G 1: 4,347,998 W964R probably benign Het
Sarnp A G 10: 128,833,378 I35V probably damaging Het
Sec23a T C 12: 58,966,999 N730S probably benign Het
Sh3d19 A G 3: 86,104,228 K374E probably benign Het
Sh3tc2 A G 18: 61,989,506 D446G probably benign Het
Sugct T A 13: 17,644,814 I149F probably damaging Het
Tle2 A G 10: 81,580,318 N142S probably damaging Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Trpm1 T A 7: 64,268,801 Y1514N probably benign Het
Ubr4 C T 4: 139,452,691 S259L unknown Het
Utp20 A T 10: 88,795,443 L892Q probably benign Het
Wdr92 A G 11: 17,232,712 Y291C probably damaging Het
Wisp3 A G 10: 39,158,265 C114R probably damaging Het
Zfp956 C T 6: 47,963,919 T404M probably damaging Het
Other mutations in Olfr1030
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01775:Olfr1030 APN 2 85984670 missense probably damaging 0.99
IGL01795:Olfr1030 APN 2 85984134 missense probably damaging 1.00
IGL02395:Olfr1030 APN 2 85984082 missense possibly damaging 0.76
IGL03277:Olfr1030 APN 2 85984173 missense probably damaging 0.99
PIT4468001:Olfr1030 UTSW 2 85984448 missense probably benign 0.10
R0458:Olfr1030 UTSW 2 85984256 missense probably benign 0.00
R1114:Olfr1030 UTSW 2 85984307 missense probably benign
R1642:Olfr1030 UTSW 2 85983857 missense probably benign 0.00
R2189:Olfr1030 UTSW 2 85984068 missense probably damaging 1.00
R4094:Olfr1030 UTSW 2 85984218 missense probably damaging 1.00
R4246:Olfr1030 UTSW 2 85984280 missense possibly damaging 0.90
R4677:Olfr1030 UTSW 2 85983971 missense possibly damaging 0.61
R5537:Olfr1030 UTSW 2 85984226 missense possibly damaging 0.83
R6018:Olfr1030 UTSW 2 85984804 utr 3 prime probably benign
R6531:Olfr1030 UTSW 2 85984307 missense probably benign
R7611:Olfr1030 UTSW 2 85984063 nonsense probably null
R7693:Olfr1030 UTSW 2 85984635 missense probably damaging 1.00
R7753:Olfr1030 UTSW 2 85984716 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- ATGCTGCGTGTTTAGTCCAG -3'
(R):5'- CCTCAAGATGGCAATGAGAATG -3'

Sequencing Primer
(F):5'- ATGGCCATCTGTAACCCT -3'
(R):5'- CTCAAGATGGCAATGAGAATGAACAG -3'
Posted On2019-09-13