Incidental Mutation 'R0646:Icam2'
ID 57187
Institutional Source Beutler Lab
Gene Symbol Icam2
Ensembl Gene ENSMUSG00000001029
Gene Name intercellular adhesion molecule 2
Synonyms Icam-2, CD102
MMRRC Submission 038831-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0646 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 106268482-106278901 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 106271717 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 71 (I71K)
Ref Sequence ENSEMBL: ENSMUSP00000118043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001055] [ENSMUST00000009354] [ENSMUST00000106813] [ENSMUST00000106816] [ENSMUST00000141146] [ENSMUST00000185986] [ENSMUST00000188561] [ENSMUST00000190268] [ENSMUST00000190795]
AlphaFold P35330
Predicted Effect possibly damaging
Transcript: ENSMUST00000001055
AA Change: I35K

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000001055
Gene: ENSMUSG00000001029
AA Change: I35K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ICAM_N 22 114 8.6e-45 PFAM
Blast:IG_like 119 215 2e-36 BLAST
transmembrane domain 224 246 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000009354
SMART Domains Protein: ENSMUSP00000009354
Gene: ENSMUSG00000009210

DomainStartEndE-ValueType
Pfam:DUF4587 1 60 9.4e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106809
Predicted Effect possibly damaging
Transcript: ENSMUST00000106813
AA Change: I35K

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102426
Gene: ENSMUSG00000001029
AA Change: I35K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ICAM_N 22 114 2.8e-45 PFAM
Blast:IG_like 119 161 9e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106816
SMART Domains Protein: ENSMUSP00000102429
Gene: ENSMUSG00000009210

DomainStartEndE-ValueType
Pfam:DUF4587 39 110 1.5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141146
AA Change: I71K

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118043
Gene: ENSMUSG00000001029
AA Change: I71K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ICAM_N 58 138 2.1e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173795
SMART Domains Protein: ENSMUSP00000133315
Gene: ENSMUSG00000001029

DomainStartEndE-ValueType
Pfam:ICAM_N 1 50 2.2e-21 PFAM
Blast:IG_like 55 151 2e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000185986
SMART Domains Protein: ENSMUSP00000140365
Gene: ENSMUSG00000009210

DomainStartEndE-ValueType
Pfam:DUF4587 32 103 1.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188561
SMART Domains Protein: ENSMUSP00000140194
Gene: ENSMUSG00000009210

DomainStartEndE-ValueType
Pfam:DUF4587 39 101 1.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190268
SMART Domains Protein: ENSMUSP00000139960
Gene: ENSMUSG00000009210

DomainStartEndE-ValueType
Pfam:DUF4587 39 110 2.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190795
SMART Domains Protein: ENSMUSP00000140541
Gene: ENSMUSG00000009210

DomainStartEndE-ValueType
Pfam:DUF4587 1 60 9.4e-20 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 95% (123/130)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the intercellular adhesion molecule (ICAM) family. All ICAM proteins are type I transmembrane glycoproteins, contain 2-9 immunoglobulin-like C2-type domains, and bind to the leukocyte adhesion LFA-1 protein. This protein may play a role in lymphocyte recirculation by blocking LFA-1-dependent cell adhesion. It mediates adhesive interactions important for antigen-specific immune response, NK-cell mediated clearance, lymphocyte recirculation, and other cellular interactions important for immune response and surveillance. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene results in increased respiratory responsiveness due to an increased accumulation of eosinophils in the lung interstitium and a concomittant delay in the increase of eosinophils in the airway lumen during the development of an allergic inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 125 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik C T 7: 29,260,710 (GRCm39) noncoding transcript Het
Abcb11 A G 2: 69,115,627 (GRCm39) I579T probably damaging Het
Abcc9 T C 6: 142,627,830 (GRCm39) N400S probably benign Het
Adarb2 T C 13: 8,781,855 (GRCm39) L577P probably damaging Het
Agt A C 8: 125,283,852 (GRCm39) N422K probably damaging Het
Ahnak A T 19: 8,990,766 (GRCm39) K4017* probably null Het
Akap13 C A 7: 75,397,494 (GRCm39) Q2575K probably damaging Het
Aldh3a2 A T 11: 61,144,541 (GRCm39) I339K probably damaging Het
Alox15 G T 11: 70,236,450 (GRCm39) Y483* probably null Het
Ampd1 A T 3: 103,006,913 (GRCm39) I713F probably damaging Het
Amph A T 13: 19,297,286 (GRCm39) E344V possibly damaging Het
Arhgef18 T C 8: 3,436,959 (GRCm39) Y250H probably damaging Het
Arid5b A G 10: 67,932,807 (GRCm39) S1032P probably damaging Het
Armc8 C A 9: 99,387,741 (GRCm39) L393F probably damaging Het
Bpnt1 A G 1: 185,077,623 (GRCm39) probably null Het
Cachd1 G A 4: 100,845,418 (GRCm39) R970H probably damaging Het
Cd207 T C 6: 83,652,738 (GRCm39) T131A probably benign Het
Cd83 G A 13: 43,951,009 (GRCm39) V54I probably benign Het
Cfap43 T C 19: 47,752,115 (GRCm39) K1086E probably benign Het
Cfap65 A T 1: 74,941,328 (GRCm39) V1837E probably benign Het
Clcnka T A 4: 141,123,917 (GRCm39) H89L probably benign Het
Cnga4 T C 7: 105,054,182 (GRCm39) I50T possibly damaging Het
Cog5 A G 12: 31,887,358 (GRCm39) probably benign Het
Col11a2 T A 17: 34,278,322 (GRCm39) probably null Het
Col28a1 T G 6: 8,175,291 (GRCm39) I186L possibly damaging Het
Col4a2 T A 8: 11,481,252 (GRCm39) M808K probably benign Het
Copb2 A G 9: 98,445,528 (GRCm39) probably benign Het
Dbnl G A 11: 5,745,441 (GRCm39) probably benign Het
Dbx2 T C 15: 95,552,493 (GRCm39) T51A possibly damaging Het
Dcp1a A T 14: 30,224,842 (GRCm39) M123L probably damaging Het
Ddx42 T A 11: 106,123,659 (GRCm39) F217I probably benign Het
Dlc1 T C 8: 37,325,205 (GRCm39) T367A probably benign Het
Dmgdh A T 13: 93,888,863 (GRCm39) T834S probably benign Het
Dnah8 T C 17: 30,903,147 (GRCm39) S929P probably damaging Het
Dnase1l2 C A 17: 24,660,056 (GRCm39) V271L possibly damaging Het
Dsc1 T C 18: 20,229,114 (GRCm39) Y392C probably damaging Het
Edn1 T C 13: 42,458,718 (GRCm39) probably benign Het
Efcab3 G A 11: 104,611,327 (GRCm39) D390N probably benign Het
Eps8l3 T C 3: 107,792,126 (GRCm39) L351P probably damaging Het
F12 G A 13: 55,570,296 (GRCm39) probably benign Het
Fam47e T C 5: 92,726,317 (GRCm39) probably benign Het
Fcrl5 C A 3: 87,349,320 (GRCm39) Q32K probably benign Het
Fndc1 C T 17: 7,960,505 (GRCm39) V1637I possibly damaging Het
Foxg1 G T 12: 49,431,350 (GRCm39) probably benign Het
Frrs1 A T 3: 116,696,070 (GRCm39) I530F possibly damaging Het
Galnt5 A T 2: 57,889,097 (GRCm39) K232N probably benign Het
Ggt5 G A 10: 75,438,482 (GRCm39) V68M probably damaging Het
Gm16519 T C 17: 71,236,101 (GRCm39) C17R probably benign Het
Gm17535 A G 9: 3,035,804 (GRCm39) Y224C probably null Het
Gm9631 T G 11: 121,836,455 (GRCm39) D28A probably damaging Het
Gpx2 T C 12: 76,842,087 (GRCm39) I21M probably benign Het
H2-Q2 T G 17: 35,564,661 (GRCm39) D354E probably damaging Het
Il12a T C 3: 68,605,223 (GRCm39) probably benign Het
Insm2 C G 12: 55,647,225 (GRCm39) A323G probably benign Het
Itga1 T C 13: 115,104,835 (GRCm39) T1064A probably benign Het
Itgad T A 7: 127,773,176 (GRCm39) V11E possibly damaging Het
Kctd15 C T 7: 34,344,306 (GRCm39) S115N probably damaging Het
Klra5 A G 6: 129,880,527 (GRCm39) W124R probably damaging Het
Kng2 T A 16: 22,806,486 (GRCm39) D571V probably benign Het
Kpna6 A T 4: 129,544,583 (GRCm39) F380I probably benign Het
Lipo3 A T 19: 33,762,169 (GRCm39) Y109* probably null Het
Lrrc37 T A 11: 103,503,986 (GRCm39) K485* probably null Het
Man2a2 T C 7: 80,012,945 (GRCm39) H540R possibly damaging Het
Map2k4 T C 11: 65,603,101 (GRCm39) E188G probably damaging Het
Mast4 T C 13: 102,895,252 (GRCm39) probably benign Het
Mbtd1 A G 11: 93,796,038 (GRCm39) D25G probably damaging Het
Med13 T A 11: 86,221,915 (GRCm39) Q238L possibly damaging Het
Mmachc A G 4: 116,560,851 (GRCm39) Y215H probably damaging Het
Mtor T A 4: 148,568,811 (GRCm39) Y1110* probably null Het
Nek2 A G 1: 191,554,331 (GRCm39) N57D probably damaging Het
Nek7 ACCCC ACCC 1: 138,443,431 (GRCm39) probably null Het
Neo1 G T 9: 58,838,317 (GRCm39) T489K probably damaging Het
Neu1 T A 17: 35,153,736 (GRCm39) Y387N probably damaging Het
Nfasc A T 1: 132,536,176 (GRCm39) C586* probably null Het
Nle1 G A 11: 82,795,671 (GRCm39) L259F probably damaging Het
Nrde2 G A 12: 100,110,105 (GRCm39) Q309* probably null Het
Nufip2 C T 11: 77,577,279 (GRCm39) H76Y probably benign Het
Or10ak16 A C 4: 118,750,687 (GRCm39) T136P probably damaging Het
Or2y13 A T 11: 49,415,405 (GRCm39) N285I probably damaging Het
Or4k6 A T 14: 50,476,096 (GRCm39) I82N probably damaging Het
Or52e18 A T 7: 104,609,018 (GRCm39) I307N probably benign Het
Or52r1c T C 7: 102,735,358 (GRCm39) F206S probably damaging Het
Or9s18 A T 13: 65,300,877 (GRCm39) I280F probably damaging Het
Pcdhb5 A G 18: 37,454,675 (GRCm39) T352A probably benign Het
Pcdhb7 A T 18: 37,476,442 (GRCm39) D526V probably damaging Het
Phkg1 A T 5: 129,893,394 (GRCm39) probably null Het
Plg C T 17: 12,637,623 (GRCm39) T744M probably damaging Het
Plxnd1 A C 6: 115,935,660 (GRCm39) probably benign Het
Poglut1 A T 16: 38,349,837 (GRCm39) I312N probably damaging Het
Ppp1r16a C T 15: 76,574,999 (GRCm39) probably benign Het
Ppt1 A G 4: 122,737,892 (GRCm39) M77V probably benign Het
Pramel26 A C 4: 143,539,155 (GRCm39) S113A possibly damaging Het
Pramel5 G T 4: 143,998,190 (GRCm39) T351N probably damaging Het
Psmb4 G A 3: 94,792,275 (GRCm39) R216C probably benign Het
Ptprd T C 4: 76,002,640 (GRCm39) T699A probably damaging Het
Retreg3 A T 11: 100,989,455 (GRCm39) probably benign Het
Sanbr C T 11: 23,525,491 (GRCm39) R716H probably damaging Het
Scaper G A 9: 55,665,340 (GRCm39) A389V probably damaging Het
Serinc5 G A 13: 92,825,245 (GRCm39) D225N possibly damaging Het
Slco1a1 T G 6: 141,871,480 (GRCm39) probably benign Het
Snapc1 C T 12: 74,021,806 (GRCm39) R81C probably damaging Het
Sod3 A T 5: 52,525,421 (GRCm39) D40V probably benign Het
Sorcs3 C A 19: 48,194,734 (GRCm39) A39E probably benign Het
Spon1 A T 7: 113,639,056 (GRCm39) T761S probably benign Het
Syde2 A G 3: 145,720,004 (GRCm39) probably null Het
Synm T A 7: 67,408,916 (GRCm39) D154V probably benign Het
Synpo2 T C 3: 122,908,098 (GRCm39) E406G probably damaging Het
Tcea3 T A 4: 135,975,382 (GRCm39) L8* probably null Het
Tec G A 5: 72,980,840 (GRCm39) L33F probably damaging Het
Tex15 T A 8: 34,072,354 (GRCm39) S2634T possibly damaging Het
Tg T A 15: 66,601,475 (GRCm39) Y162N probably damaging Het
Tmem8b G A 4: 43,690,123 (GRCm39) V853I probably benign Het
Togaram1 A G 12: 65,068,240 (GRCm39) K1748E probably damaging Het
Ttn T C 2: 76,728,822 (GRCm39) probably benign Het
Usp36 C T 11: 118,163,847 (GRCm39) D234N probably damaging Het
Usp40 G A 1: 87,906,244 (GRCm39) P664S probably benign Het
Vmn1r54 T A 6: 90,246,635 (GRCm39) L183H probably benign Het
Vmn1r58 T G 7: 5,413,676 (GRCm39) I185L probably benign Het
Wnt8a A T 18: 34,680,618 (GRCm39) R328W probably benign Het
Yars1 A G 4: 129,107,732 (GRCm39) probably benign Het
Zbtb49 A C 5: 38,358,018 (GRCm39) M745R probably damaging Het
Zeb1 T G 18: 5,759,027 (GRCm39) F162V probably damaging Het
Zfp369 A T 13: 65,445,362 (GRCm39) H835L probably damaging Het
Zic5 A G 14: 122,701,351 (GRCm39) V460A unknown Het
Zp3 A G 5: 136,013,210 (GRCm39) N181D possibly damaging Het
Other mutations in Icam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1651:Icam2 UTSW 11 106,268,782 (GRCm39) missense probably damaging 1.00
R2026:Icam2 UTSW 11 106,273,268 (GRCm39) missense probably benign 0.01
R3804:Icam2 UTSW 11 106,271,648 (GRCm39) missense probably damaging 1.00
R4092:Icam2 UTSW 11 106,271,623 (GRCm39) start codon destroyed probably null
R5395:Icam2 UTSW 11 106,273,299 (GRCm39) splice site probably null
R6575:Icam2 UTSW 11 106,269,585 (GRCm39) missense probably damaging 0.99
R6722:Icam2 UTSW 11 106,273,307 (GRCm39) missense probably damaging 0.99
R7221:Icam2 UTSW 11 106,273,268 (GRCm39) missense probably benign 0.01
R7579:Icam2 UTSW 11 106,271,589 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGTTGAGACTCTCCGAGTGCTGC -3'
(R):5'- CATTGTACGGGAGCTTAAGGAAGCC -3'

Sequencing Primer
(F):5'- GAGTGCTGCTTTCCCGAAC -3'
(R):5'- TAGGCTTGAGGAAGACTGACC -3'
Posted On 2013-07-11