Incidental Mutation 'R7367:Cyp2s1'
ID571876
Institutional Source Beutler Lab
Gene Symbol Cyp2s1
Ensembl Gene ENSMUSG00000040703
Gene Namecytochrome P450, family 2, subfamily s, polypeptide 1
Synonyms1200011C15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7367 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location25802475-25816913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25805973 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 355 (D355E)
Ref Sequence ENSEMBL: ENSMUSP00000041175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043314] [ENSMUST00000108395] [ENSMUST00000156714]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043314
AA Change: D355E

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041175
Gene: ENSMUSG00000040703
AA Change: D355E

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:p450 34 493 6.4e-122 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108395
AA Change: D355E

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104032
Gene: ENSMUSG00000040703
AA Change: D355E

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:p450 34 440 4e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156714
SMART Domains Protein: ENSMUSP00000122264
Gene: ENSMUSG00000040703

DomainStartEndE-ValueType
Pfam:p450 1 91 1.2e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. In rodents, the homologous protein has been shown to metabolize certain carcinogens; however, the specific function of the human protein has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and appear normal in terms of body weight, growth rate, organ weight, and daily activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 A G 3: 138,290,551 T374A probably benign Het
Agps T A 2: 75,868,313 H348Q possibly damaging Het
Als2cr12 A T 1: 58,666,864 I282N probably benign Het
Ankrd34b C A 13: 92,438,287 T9K probably benign Het
Atp10b A G 11: 43,247,501 Q1203R probably damaging Het
B4galnt4 A G 7: 141,064,475 N123D probably damaging Het
C530008M17Rik T A 5: 76,856,602 L270Q unknown Het
Cep250 A G 2: 155,969,307 T358A probably benign Het
Cfh A T 1: 140,086,521 H1188Q probably damaging Het
Cisd1 A G 10: 71,336,360 Y31H probably damaging Het
Cnga1 G A 5: 72,605,358 S271F possibly damaging Het
Cntnap5a A G 1: 116,442,295 T881A probably benign Het
Dnah11 T A 12: 117,987,442 R3044W possibly damaging Het
Dnah17 T C 11: 118,115,196 D730G probably benign Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fsd2 A G 7: 81,535,180 I656T probably damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gm45871 A T 18: 90,591,100 H154L probably benign Het
Golgb1 T A 16: 36,898,546 N312K probably benign Het
Hist1h2ab A G 13: 23,751,350 D73G possibly damaging Het
Hsd17b4 T A 18: 50,155,185 H227Q probably damaging Het
Hsd17b6 A T 10: 127,993,623 S237T probably benign Het
Htra4 A T 8: 25,033,697 V284E probably damaging Het
Kcnv1 C T 15: 45,109,242 C415Y probably damaging Het
Kif11 T A 19: 37,420,341 L1037H probably benign Het
Lama5 T C 2: 180,192,958 T1347A probably benign Het
Lrrc32 G T 7: 98,498,879 E289* probably null Het
Lrrc66 T C 5: 73,608,381 T440A probably benign Het
Neurl4 T C 11: 69,908,582 L928P probably damaging Het
Nos2 G A 11: 78,950,090 C788Y possibly damaging Het
Olfr1030 T C 2: 85,984,343 W168R possibly damaging Het
Olfr1265 A G 2: 90,037,812 S298G probably benign Het
Olfr15 A G 16: 3,839,302 T110A probably damaging Het
Pafah1b3 A G 7: 25,296,066 C156R probably benign Het
Pak1ip1 T G 13: 41,008,895 N151K probably damaging Het
Pax7 G A 4: 139,779,749 P326S probably benign Het
Pex11b G A 3: 96,636,678 A21T probably damaging Het
Pkn2 A G 3: 142,810,727 V546A probably benign Het
Ppat T A 5: 76,919,864 R260* probably null Het
Ppp1r13l C G 7: 19,370,156 S187R probably benign Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
R3hdm1 A G 1: 128,153,392 D55G possibly damaging Het
Rev1 A T 1: 38,074,407 Y526* probably null Het
Rp1 A G 1: 4,347,998 W964R probably benign Het
Sarnp A G 10: 128,833,378 I35V probably damaging Het
Sec23a T C 12: 58,966,999 N730S probably benign Het
Sh3d19 A G 3: 86,104,228 K374E probably benign Het
Sh3tc2 A G 18: 61,989,506 D446G probably benign Het
Sugct T A 13: 17,644,814 I149F probably damaging Het
Tle2 A G 10: 81,580,318 N142S probably damaging Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Trpm1 T A 7: 64,268,801 Y1514N probably benign Het
Ubr4 C T 4: 139,452,691 S259L unknown Het
Utp20 A T 10: 88,795,443 L892Q probably benign Het
Wdr92 A G 11: 17,232,712 Y291C probably damaging Het
Wisp3 A G 10: 39,158,265 C114R probably damaging Het
Zfp956 C T 6: 47,963,919 T404M probably damaging Het
Other mutations in Cyp2s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Cyp2s1 APN 7 25809258 missense probably damaging 1.00
IGL02415:Cyp2s1 APN 7 25808137 missense probably damaging 1.00
IGL02530:Cyp2s1 APN 7 25816424 unclassified probably benign
IGL02927:Cyp2s1 APN 7 25808152 missense probably benign 0.17
IGL03358:Cyp2s1 APN 7 25808148 missense probably damaging 1.00
R0139:Cyp2s1 UTSW 7 25811689 utr 5 prime probably null
R0523:Cyp2s1 UTSW 7 25806050 missense probably damaging 1.00
R0650:Cyp2s1 UTSW 7 25809258 missense probably damaging 1.00
R0652:Cyp2s1 UTSW 7 25809258 missense probably damaging 1.00
R0723:Cyp2s1 UTSW 7 25809548 missense probably benign 0.01
R1086:Cyp2s1 UTSW 7 25805997 missense probably damaging 1.00
R3732:Cyp2s1 UTSW 7 25803954 missense probably null 0.08
R3732:Cyp2s1 UTSW 7 25803954 missense probably null 0.08
R3733:Cyp2s1 UTSW 7 25803954 missense probably null 0.08
R3813:Cyp2s1 UTSW 7 25805866 splice site probably null
R3958:Cyp2s1 UTSW 7 25803954 missense probably null 0.08
R4593:Cyp2s1 UTSW 7 25816442 unclassified probably benign
R4965:Cyp2s1 UTSW 7 25809285 missense possibly damaging 0.85
R5278:Cyp2s1 UTSW 7 25805884 missense possibly damaging 0.95
R5642:Cyp2s1 UTSW 7 25816319 splice site probably null
R6258:Cyp2s1 UTSW 7 25816442 unclassified probably benign
R6628:Cyp2s1 UTSW 7 25815041 missense probably benign 0.02
R6762:Cyp2s1 UTSW 7 25808070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCCTCCAGAGACAGGGATATC -3'
(R):5'- TATCCAACACAGGCTGACG -3'

Sequencing Primer
(F):5'- CTCCAGAGACAGGGATATCAAAACG -3'
(R):5'- TCATCGGCTGCCAGTCC -3'
Posted On2019-09-13