Incidental Mutation 'R7367:Pwp2'
ID571885
Institutional Source Beutler Lab
Gene Symbol Pwp2
Ensembl Gene ENSMUSG00000032834
Gene NamePWP2 periodic tryptophan protein homolog (yeast)
SynonymsPwp2, Pwp2h, 6530411D08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.833) question?
Stock #R7367 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location78170909-78185149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 78182480 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 126 (G126R)
Ref Sequence ENSEMBL: ENSMUSP00000045812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000384] [ENSMUST00000042556]
Predicted Effect probably benign
Transcript: ENSMUST00000000384
SMART Domains Protein: ENSMUSP00000000384
Gene: ENSMUSG00000000374

DomainStartEndE-ValueType
Pfam:TRAPPC10 1016 1245 1.1e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000042556
AA Change: G126R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045812
Gene: ENSMUSG00000032834
AA Change: G126R

DomainStartEndE-ValueType
WD40 43 83 1.47e2 SMART
WD40 86 123 1.78e1 SMART
WD40 133 172 5.35e-1 SMART
WD40 177 216 8.29e-1 SMART
low complexity region 239 254 N/A INTRINSIC
WD40 273 316 1.9e2 SMART
WD40 319 359 4.44e0 SMART
WD40 362 401 7.44e-8 SMART
WD40 404 443 3.87e-6 SMART
WD40 446 487 5.7e1 SMART
WD40 490 529 1.28e-11 SMART
WD40 533 571 9.94e-1 SMART
WD40 594 633 4.95e0 SMART
WD40 692 729 2.21e1 SMART
Pfam:Utp12 771 875 9.4e-25 PFAM
low complexity region 890 902 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 A G 3: 138,290,551 T374A probably benign Het
Agps T A 2: 75,868,313 H348Q possibly damaging Het
Als2cr12 A T 1: 58,666,864 I282N probably benign Het
Ankrd34b C A 13: 92,438,287 T9K probably benign Het
Atp10b A G 11: 43,247,501 Q1203R probably damaging Het
B4galnt4 A G 7: 141,064,475 N123D probably damaging Het
C530008M17Rik T A 5: 76,856,602 L270Q unknown Het
Cep250 A G 2: 155,969,307 T358A probably benign Het
Cfh A T 1: 140,086,521 H1188Q probably damaging Het
Cisd1 A G 10: 71,336,360 Y31H probably damaging Het
Cnga1 G A 5: 72,605,358 S271F possibly damaging Het
Cntnap5a A G 1: 116,442,295 T881A probably benign Het
Cyp2s1 A T 7: 25,805,973 D355E possibly damaging Het
Dnah11 T A 12: 117,987,442 R3044W possibly damaging Het
Dnah17 T C 11: 118,115,196 D730G probably benign Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fsd2 A G 7: 81,535,180 I656T probably damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gm45871 A T 18: 90,591,100 H154L probably benign Het
Golgb1 T A 16: 36,898,546 N312K probably benign Het
Hist1h2ab A G 13: 23,751,350 D73G possibly damaging Het
Hsd17b4 T A 18: 50,155,185 H227Q probably damaging Het
Hsd17b6 A T 10: 127,993,623 S237T probably benign Het
Htra4 A T 8: 25,033,697 V284E probably damaging Het
Kcnv1 C T 15: 45,109,242 C415Y probably damaging Het
Kif11 T A 19: 37,420,341 L1037H probably benign Het
Lama5 T C 2: 180,192,958 T1347A probably benign Het
Lrrc32 G T 7: 98,498,879 E289* probably null Het
Lrrc66 T C 5: 73,608,381 T440A probably benign Het
Neurl4 T C 11: 69,908,582 L928P probably damaging Het
Nos2 G A 11: 78,950,090 C788Y possibly damaging Het
Olfr1030 T C 2: 85,984,343 W168R possibly damaging Het
Olfr1265 A G 2: 90,037,812 S298G probably benign Het
Olfr15 A G 16: 3,839,302 T110A probably damaging Het
Pafah1b3 A G 7: 25,296,066 C156R probably benign Het
Pak1ip1 T G 13: 41,008,895 N151K probably damaging Het
Pax7 G A 4: 139,779,749 P326S probably benign Het
Pex11b G A 3: 96,636,678 A21T probably damaging Het
Pkn2 A G 3: 142,810,727 V546A probably benign Het
Ppat T A 5: 76,919,864 R260* probably null Het
Ppp1r13l C G 7: 19,370,156 S187R probably benign Het
R3hdm1 A G 1: 128,153,392 D55G possibly damaging Het
Rev1 A T 1: 38,074,407 Y526* probably null Het
Rp1 A G 1: 4,347,998 W964R probably benign Het
Sarnp A G 10: 128,833,378 I35V probably damaging Het
Sec23a T C 12: 58,966,999 N730S probably benign Het
Sh3d19 A G 3: 86,104,228 K374E probably benign Het
Sh3tc2 A G 18: 61,989,506 D446G probably benign Het
Sugct T A 13: 17,644,814 I149F probably damaging Het
Tle2 A G 10: 81,580,318 N142S probably damaging Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Trpm1 T A 7: 64,268,801 Y1514N probably benign Het
Ubr4 C T 4: 139,452,691 S259L unknown Het
Utp20 A T 10: 88,795,443 L892Q probably benign Het
Wdr92 A G 11: 17,232,712 Y291C probably damaging Het
Wisp3 A G 10: 39,158,265 C114R probably damaging Het
Zfp956 C T 6: 47,963,919 T404M probably damaging Het
Other mutations in Pwp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01892:Pwp2 APN 10 78179007 missense probably damaging 1.00
IGL02163:Pwp2 APN 10 78178285 missense possibly damaging 0.82
IGL02280:Pwp2 APN 10 78184100 missense probably damaging 0.99
IGL02558:Pwp2 APN 10 78179065 missense probably damaging 1.00
IGL02560:Pwp2 APN 10 78179065 missense probably damaging 1.00
IGL02583:Pwp2 APN 10 78181083 missense probably benign
IGL02612:Pwp2 APN 10 78182994 missense probably damaging 0.97
PIT4283001:Pwp2 UTSW 10 78185087 start codon destroyed probably null 1.00
PIT4449001:Pwp2 UTSW 10 78178470 missense probably benign 0.38
R0573:Pwp2 UTSW 10 78182686 missense probably benign 0.37
R1835:Pwp2 UTSW 10 78179091 missense probably damaging 1.00
R2097:Pwp2 UTSW 10 78177742 splice site probably benign
R2251:Pwp2 UTSW 10 78181088 missense probably benign 0.04
R2967:Pwp2 UTSW 10 78182698 missense possibly damaging 0.94
R4909:Pwp2 UTSW 10 78182494 missense possibly damaging 0.51
R4950:Pwp2 UTSW 10 78183006 missense probably benign 0.00
R4970:Pwp2 UTSW 10 78173693 missense possibly damaging 0.95
R5015:Pwp2 UTSW 10 78182693 missense probably benign 0.23
R5355:Pwp2 UTSW 10 78175544 missense possibly damaging 0.94
R5390:Pwp2 UTSW 10 78177771 missense possibly damaging 0.63
R5416:Pwp2 UTSW 10 78183001 missense probably damaging 1.00
R5841:Pwp2 UTSW 10 78172118 missense probably benign 0.00
R5928:Pwp2 UTSW 10 78182456 missense probably damaging 0.98
R6495:Pwp2 UTSW 10 78177127 missense probably damaging 1.00
R6771:Pwp2 UTSW 10 78182388 splice site probably null
R6848:Pwp2 UTSW 10 78184293 intron probably null
R6897:Pwp2 UTSW 10 78172083 missense probably damaging 1.00
R7060:Pwp2 UTSW 10 78173250 intron probably null
R7269:Pwp2 UTSW 10 78176336 missense probably benign 0.30
R7368:Pwp2 UTSW 10 78182480 missense probably damaging 1.00
R7394:Pwp2 UTSW 10 78182480 missense probably damaging 1.00
R7728:Pwp2 UTSW 10 78178561 missense probably benign 0.00
R7838:Pwp2 UTSW 10 78182944 critical splice donor site probably null
R7898:Pwp2 UTSW 10 78173406 missense probably damaging 1.00
R8072:Pwp2 UTSW 10 78172096 missense possibly damaging 0.82
Z1177:Pwp2 UTSW 10 78171974 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGACCAAACTACAATGGGCTC -3'
(R):5'- CACTTCCACTTCAAGGGCTC -3'

Sequencing Primer
(F):5'- ACTACAATGGGCTCATGGC -3'
(R):5'- ACTTCAAGGGCTCCGTGC -3'
Posted On2019-09-13