Incidental Mutation 'R7367:Nos2'
ID 571893
Institutional Source Beutler Lab
Gene Symbol Nos2
Ensembl Gene ENSMUSG00000020826
Gene Name nitric oxide synthase 2, inducible
Synonyms iNOS, Nos-2, Nos2a, NOS-II
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7367 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 78920787-78960254 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 78950090 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 788 (C788Y)
Ref Sequence ENSEMBL: ENSMUSP00000018610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018610] [ENSMUST00000214397]
AlphaFold P29477
PDB Structure MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DOMAIN (DELTA 114) (N-[(1,3-BENZODIOXOL-5-YL)METHYL]-1-[2-(1H-IMIDAZOL-1-YL)PYRIMIDIN-4-YL]-4-(METHOXYCARBONYL)-PIPERAZINE-2-ACETAMIDE COMPLEX [X-RAY DIFFRACTION]
MURINE INOSOXY DIMER WITH ISOTHIOUREA BOUND IN THE ACTIVE SITE [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND 4-AMINO TETRAHYDROBIOPTERIN [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND DIHYDROBIOPTERIN [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND TETRAHYDROBIOPTERIN [X-RAY DIFFRACTION]
Murine Inducible Nitric Oxide Synthase Oxygenase Dimer (Delta 65) with W457F Mutation at Tetrahydrobiopterin Binding Site [X-RAY DIFFRACTION]
Murine Inducible Nitric Oxide Synthase Oxygenase Dimer (Delta 65) with W457A Mutation at Tetrahydrobiopterin Binding Site [X-RAY DIFFRACTION]
inducible nitric oxide synthase with Chlorzoxazone bound [X-RAY DIFFRACTION]
inducible nitric oxide synthase with 7-nitroindazole bound [X-RAY DIFFRACTION]
inducible nitric oxide synthase with 6-nitroindazole bound [X-RAY DIFFRACTION]
>> 40 additional structures at PDB <<
Predicted Effect possibly damaging
Transcript: ENSMUST00000018610
AA Change: C788Y

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000018610
Gene: ENSMUSG00000020826
AA Change: C788Y

DomainStartEndE-ValueType
Pfam:NO_synthase 129 491 6.7e-189 PFAM
Pfam:Flavodoxin_1 535 666 5.5e-43 PFAM
Pfam:FAD_binding_1 719 941 8.8e-79 PFAM
Pfam:NAD_binding_1 973 1087 4.1e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214397
AA Change: C675Y

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. This gene encodes a nitric oxide synthase that is inducible by a combination of lipopolysaccharide and certain cytokines. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous deletion of this gene alters susceptibility to infection, response to injury, sepsis and sensory stimuli, cardiac function, osteoclast, platelet and mammary gland physiology, tumor growth, testis and uterus morphology, diet-induced atherosclerosis, and blood, urine and glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 A G 3: 138,290,551 T374A probably benign Het
Agps T A 2: 75,868,313 H348Q possibly damaging Het
Als2cr12 A T 1: 58,666,864 I282N probably benign Het
Ankrd34b C A 13: 92,438,287 T9K probably benign Het
Atp10b A G 11: 43,247,501 Q1203R probably damaging Het
B4galnt4 A G 7: 141,064,475 N123D probably damaging Het
C530008M17Rik T A 5: 76,856,602 L270Q unknown Het
Cep250 A G 2: 155,969,307 T358A probably benign Het
Cfh A T 1: 140,086,521 H1188Q probably damaging Het
Cisd1 A G 10: 71,336,360 Y31H probably damaging Het
Cnga1 G A 5: 72,605,358 S271F possibly damaging Het
Cntnap5a A G 1: 116,442,295 T881A probably benign Het
Cyp2s1 A T 7: 25,805,973 D355E possibly damaging Het
Dnah11 T A 12: 117,987,442 R3044W possibly damaging Het
Dnah17 T C 11: 118,115,196 D730G probably benign Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fsd2 A G 7: 81,535,180 I656T probably damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gm45871 A T 18: 90,591,100 H154L probably benign Het
Golgb1 T A 16: 36,898,546 N312K probably benign Het
Hist1h2ab A G 13: 23,751,350 D73G possibly damaging Het
Hsd17b4 T A 18: 50,155,185 H227Q probably damaging Het
Hsd17b6 A T 10: 127,993,623 S237T probably benign Het
Htra4 A T 8: 25,033,697 V284E probably damaging Het
Kcnv1 C T 15: 45,109,242 C415Y probably damaging Het
Kif11 T A 19: 37,420,341 L1037H probably benign Het
Lama5 T C 2: 180,192,958 T1347A probably benign Het
Lrrc32 G T 7: 98,498,879 E289* probably null Het
Lrrc66 T C 5: 73,608,381 T440A probably benign Het
Neurl4 T C 11: 69,908,582 L928P probably damaging Het
Olfr1030 T C 2: 85,984,343 W168R possibly damaging Het
Olfr1265 A G 2: 90,037,812 S298G probably benign Het
Olfr15 A G 16: 3,839,302 T110A probably damaging Het
Pafah1b3 A G 7: 25,296,066 C156R probably benign Het
Pak1ip1 T G 13: 41,008,895 N151K probably damaging Het
Pax7 G A 4: 139,779,749 P326S probably benign Het
Pex11b G A 3: 96,636,678 A21T probably damaging Het
Pkn2 A G 3: 142,810,727 V546A probably benign Het
Ppat T A 5: 76,919,864 R260* probably null Het
Ppp1r13l C G 7: 19,370,156 S187R probably benign Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
R3hdm1 A G 1: 128,153,392 D55G possibly damaging Het
Rev1 A T 1: 38,074,407 Y526* probably null Het
Rp1 A G 1: 4,347,998 W964R probably benign Het
Sarnp A G 10: 128,833,378 I35V probably damaging Het
Sec23a T C 12: 58,966,999 N730S probably benign Het
Sh3d19 A G 3: 86,104,228 K374E probably benign Het
Sh3tc2 A G 18: 61,989,506 D446G probably benign Het
Sugct T A 13: 17,644,814 I149F probably damaging Het
Tle2 A G 10: 81,580,318 N142S probably damaging Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Trpm1 T A 7: 64,268,801 Y1514N probably benign Het
Ubr4 C T 4: 139,452,691 S259L unknown Het
Utp20 A T 10: 88,795,443 L892Q probably benign Het
Wdr92 A G 11: 17,232,712 Y291C probably damaging Het
Wisp3 A G 10: 39,158,265 C114R probably damaging Het
Zfp956 C T 6: 47,963,919 T404M probably damaging Het
Other mutations in Nos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Nos2 APN 11 78957452 missense probably damaging 0.96
IGL01503:Nos2 APN 11 78945863 splice site probably benign
IGL01789:Nos2 APN 11 78944657 splice site probably benign
IGL02797:Nos2 APN 11 78940344 missense probably damaging 1.00
IGL02968:Nos2 APN 11 78937637 missense probably damaging 1.00
R6762_Nos2_754 UTSW 11 78959748 missense possibly damaging 0.90
R0035:Nos2 UTSW 11 78945727 missense probably damaging 1.00
R0265:Nos2 UTSW 11 78937602 missense probably damaging 0.98
R0441:Nos2 UTSW 11 78928583 missense probably benign 0.10
R0504:Nos2 UTSW 11 78940077 missense probably damaging 1.00
R0570:Nos2 UTSW 11 78935361 missense possibly damaging 0.49
R1356:Nos2 UTSW 11 78952803 missense probably benign 0.00
R1538:Nos2 UTSW 11 78956570 missense probably benign 0.00
R3414:Nos2 UTSW 11 78957588 missense probably benign 0.14
R3418:Nos2 UTSW 11 78959695 missense possibly damaging 0.47
R4279:Nos2 UTSW 11 78929776 missense probably benign 0.01
R4492:Nos2 UTSW 11 78950095 missense probably benign
R4632:Nos2 UTSW 11 78957591 missense possibly damaging 0.95
R4686:Nos2 UTSW 11 78928630 missense possibly damaging 0.65
R5038:Nos2 UTSW 11 78922314 missense probably benign
R5214:Nos2 UTSW 11 78955441 missense probably damaging 1.00
R5377:Nos2 UTSW 11 78957491 missense probably benign 0.00
R5777:Nos2 UTSW 11 78940152 missense probably null 1.00
R5834:Nos2 UTSW 11 78928579 missense probably benign 0.01
R5930:Nos2 UTSW 11 78937915 missense probably damaging 1.00
R6511:Nos2 UTSW 11 78955464 splice site probably null
R6706:Nos2 UTSW 11 78944723 missense possibly damaging 0.60
R6747:Nos2 UTSW 11 78952954 missense probably damaging 0.99
R6762:Nos2 UTSW 11 78959748 missense possibly damaging 0.90
R6817:Nos2 UTSW 11 78945266 missense possibly damaging 0.64
R6868:Nos2 UTSW 11 78957506 missense probably benign 0.02
R6917:Nos2 UTSW 11 78951227 missense possibly damaging 0.50
R7082:Nos2 UTSW 11 78928579 missense probably benign 0.02
R7286:Nos2 UTSW 11 78929854 missense probably damaging 1.00
R7398:Nos2 UTSW 11 78936471 nonsense probably null
R7411:Nos2 UTSW 11 78944855 critical splice donor site probably null
R7469:Nos2 UTSW 11 78952971 missense possibly damaging 0.94
R7736:Nos2 UTSW 11 78922366 nonsense probably null
R8694:Nos2 UTSW 11 78945689 missense possibly damaging 0.93
R8832:Nos2 UTSW 11 78955464 splice site probably null
R8872:Nos2 UTSW 11 78949123 missense probably damaging 0.99
R8952:Nos2 UTSW 11 78945263 missense probably benign 0.00
R9433:Nos2 UTSW 11 78959664 missense probably damaging 1.00
R9580:Nos2 UTSW 11 78937631 missense probably benign 0.01
R9612:Nos2 UTSW 11 78949158 missense probably damaging 1.00
R9727:Nos2 UTSW 11 78952999 missense possibly damaging 0.51
R9747:Nos2 UTSW 11 78931646 missense probably damaging 0.96
X0063:Nos2 UTSW 11 78922367 missense probably benign 0.01
Z1177:Nos2 UTSW 11 78931672 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATCCTGGGGTAACTGGCAGTC -3'
(R):5'- CAGGTTTTGCTCCTCCAGTG -3'

Sequencing Primer
(F):5'- TAACTGGCAGTCACCCATGG -3'
(R):5'- TCCAGTGCCTCGTCCAAG -3'
Posted On 2019-09-13