Incidental Mutation 'R7368:Ptpn3'
ID571915
Institutional Source Beutler Lab
Gene Symbol Ptpn3
Ensembl Gene ENSMUSG00000038764
Gene Nameprotein tyrosine phosphatase, non-receptor type 3
Synonyms9530011I20Rik, PTPCL, PTP-H1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.578) question?
Stock #R7368 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location57190841-57301837 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57221993 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 566 (D566G)
Ref Sequence ENSEMBL: ENSMUSP00000075063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075637]
Predicted Effect probably damaging
Transcript: ENSMUST00000075637
AA Change: D566G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075063
Gene: ENSMUSG00000038764
AA Change: D566G

DomainStartEndE-ValueType
B41 25 222 2.44e-67 SMART
FERM_C 226 316 2.64e-25 SMART
low complexity region 454 470 N/A INTRINSIC
PDZ 519 598 1.65e-15 SMART
PTPc 645 903 5.66e-117 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This protein contains a C-terminal PTP domain and an N-terminal domain homologous to the band 4.1 superfamily of cytoskeletal-associated proteins. P97, a cell cycle regulator involved in a variety of membrane related functions, has been shown to be a substrate of this PTP. This PTP was also found to interact with, and be regulated by adaptor protein 14-3-3 beta. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit increased body weight, especially in males, and male mice exhibit increased bone mineral content. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 A T 12: 84,612,865 F153I possibly damaging Het
Adcy1 G A 11: 7,144,765 V564I probably damaging Het
Apol9b T C 15: 77,735,934 I310T possibly damaging Het
Arhgef28 C A 13: 97,996,862 V366F probably benign Het
B020004C17Rik C T 14: 57,017,316 T199I possibly damaging Het
Carmil2 C T 8: 105,690,835 T575I possibly damaging Het
Catsper1 A T 19: 5,336,663 Q308L unknown Het
Cpa2 T A 6: 30,551,990 S239T probably damaging Het
Ddit3 G A 10: 127,295,907 G108D probably damaging Het
Dnah3 T C 7: 120,029,016 I1473V probably benign Het
Dscam A G 16: 96,643,931 V1520A probably benign Het
Edc4 TAGTAGCAGCAGCAGTAGCAGCAGCAG TAGTAGCAGCAGCAG 8: 105,888,405 probably benign Het
Ednrb T A 14: 103,820,017 I370F probably benign Het
Ehd3 A G 17: 73,827,462 E272G possibly damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam49b A T 15: 63,938,658 probably null Het
Fkbp11 T C 15: 98,724,426 K189E unknown Het
Frem1 T A 4: 82,966,144 E1190D probably benign Het
Gabrg2 A C 11: 41,976,563 Y76* probably null Het
Gm11437 T A 11: 84,167,472 probably benign Het
Gm8947 C A 1: 151,193,096 Q227K probably benign Het
Gm9195 A G 14: 72,480,056 F279S probably damaging Het
Gpbp1l1 T C 4: 116,573,458 I42T probably benign Het
Hdac5 A T 11: 102,197,381 V939E probably null Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kitl A T 10: 100,016,081 I21F probably benign Het
Krt1 T C 15: 101,846,872 D484G probably damaging Het
Larp1 C A 11: 58,048,078 P527T probably damaging Het
Lrp5 A G 19: 3,620,085 V673A possibly damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Mmp27 G A 9: 7,577,317 V228M probably damaging Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo15 G T 11: 60,490,915 probably null Het
Myt1 A G 2: 181,782,591 K26E possibly damaging Het
Nek1 T A 8: 61,089,707 I777N probably benign Het
Nlrc5 C T 8: 94,476,393 R374* probably null Het
Nol8 T C 13: 49,661,219 S268P probably benign Het
Nynrin T A 14: 55,870,511 L1025Q probably damaging Het
Olfr1099 A G 2: 86,959,258 S67P probably damaging Het
Osbpl3 A T 6: 50,348,098 L140H probably damaging Het
Pcnt T C 10: 76,400,001 N1382S probably benign Het
Pef1 T A 4: 130,127,385 L244* probably null Het
Phf11a T C 14: 59,280,725 E191G probably benign Het
Polr3a A T 14: 24,467,076 D702E probably damaging Het
Ptch1 C T 13: 63,511,984 G1285D probably benign Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
Scgb1b12 T C 7: 32,334,567 I84T probably damaging Het
Sh2b1 A T 7: 126,468,513 D618E possibly damaging Het
Slc35f5 T A 1: 125,584,519 V352E probably damaging Het
Sppl2c A G 11: 104,187,604 E410G probably damaging Het
St6galnac2 T C 11: 116,679,979 Y261C probably damaging Het
Stra6 G A 9: 58,151,260 R468Q probably benign Het
Taf3 T C 2: 9,916,377 H924R unknown Het
Tbx18 C A 9: 87,730,697 V50L probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Unc45b C T 11: 82,942,495 T845I probably benign Het
Usp15 T C 10: 123,196,893 D8G possibly damaging Het
Vmn2r91 A G 17: 18,136,278 I736V possibly damaging Het
Vps13c C A 9: 67,914,073 D1288E probably benign Het
Zfp458 T A 13: 67,257,236 M380L probably benign Het
Zfp638 A G 6: 83,929,455 N201D possibly damaging Het
Other mutations in Ptpn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Ptpn3 APN 4 57270050 missense possibly damaging 0.95
IGL01090:Ptpn3 APN 4 57240833 missense probably damaging 1.00
IGL01399:Ptpn3 APN 4 57225775 missense probably benign 0.01
IGL01413:Ptpn3 APN 4 57270156 missense probably damaging 0.96
IGL01418:Ptpn3 APN 4 57270156 missense probably damaging 0.96
IGL01806:Ptpn3 APN 4 57254915 critical splice donor site probably null
IGL01933:Ptpn3 APN 4 57197576 missense probably benign 0.00
IGL02087:Ptpn3 APN 4 57222019 missense probably damaging 1.00
IGL02269:Ptpn3 APN 4 57197510 missense possibly damaging 0.72
IGL02413:Ptpn3 APN 4 57205020 missense probably damaging 1.00
IGL03163:Ptpn3 APN 4 57222020 missense probably damaging 1.00
R0179:Ptpn3 UTSW 4 57270118 missense probably benign 0.00
R0240:Ptpn3 UTSW 4 57232374 missense probably benign
R0240:Ptpn3 UTSW 4 57232374 missense probably benign
R0310:Ptpn3 UTSW 4 57204958 missense probably benign 0.00
R0492:Ptpn3 UTSW 4 57194304 missense probably benign
R0631:Ptpn3 UTSW 4 57204921 missense probably damaging 0.99
R0656:Ptpn3 UTSW 4 57270075 missense probably benign 0.41
R1443:Ptpn3 UTSW 4 57225775 missense probably benign 0.01
R1741:Ptpn3 UTSW 4 57254922 missense probably damaging 1.00
R1856:Ptpn3 UTSW 4 57239682 missense probably damaging 1.00
R3753:Ptpn3 UTSW 4 57270144 missense probably damaging 1.00
R4431:Ptpn3 UTSW 4 57235355 missense probably damaging 0.97
R4704:Ptpn3 UTSW 4 57270119 missense possibly damaging 0.79
R4935:Ptpn3 UTSW 4 57197568 missense probably damaging 1.00
R5119:Ptpn3 UTSW 4 57218513 missense possibly damaging 0.93
R5410:Ptpn3 UTSW 4 57205019 missense probably damaging 1.00
R5554:Ptpn3 UTSW 4 57240843 missense probably damaging 0.99
R6024:Ptpn3 UTSW 4 57248653 splice site probably null
R6061:Ptpn3 UTSW 4 57248681 missense probably damaging 1.00
R6212:Ptpn3 UTSW 4 57270070 missense probably damaging 1.00
R6213:Ptpn3 UTSW 4 57265012 missense probably damaging 1.00
R6239:Ptpn3 UTSW 4 57249981 missense probably benign
R6444:Ptpn3 UTSW 4 57195730 missense possibly damaging 0.51
R6606:Ptpn3 UTSW 4 57265104 splice site probably null
R6656:Ptpn3 UTSW 4 57205905 missense probably damaging 0.99
R6730:Ptpn3 UTSW 4 57270088 missense probably benign
R7133:Ptpn3 UTSW 4 57225863 missense probably benign 0.30
R7231:Ptpn3 UTSW 4 57245062 missense probably damaging 1.00
R7237:Ptpn3 UTSW 4 57239625 missense probably damaging 1.00
R7604:Ptpn3 UTSW 4 57240845 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCAACTGGGTAGACAAGCC -3'
(R):5'- TACCTTCAGAGCCACTTTAAAATCC -3'

Sequencing Primer
(F):5'- GGTAGACAAGCCGCTGC -3'
(R):5'- TGATGACAGCAATGCCCAG -3'
Posted On2019-09-13