Incidental Mutation 'R7368:Gpbp1l1'
ID 571917
Institutional Source Beutler Lab
Gene Symbol Gpbp1l1
Ensembl Gene ENSMUSG00000034042
Gene Name GC-rich promoter binding protein 1-like 1
Synonyms 5330440M15Rik
MMRRC Submission 045452-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7368 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 116414855-116451079 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 116430655 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 42 (I42T)
Ref Sequence ENSEMBL: ENSMUSP00000030460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030460] [ENSMUST00000106475]
AlphaFold Q6NZP2
Predicted Effect probably benign
Transcript: ENSMUST00000030460
AA Change: I42T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000030460
Gene: ENSMUSG00000034042
AA Change: I42T

DomainStartEndE-ValueType
low complexity region 204 219 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 289 320 N/A INTRINSIC
Pfam:Vasculin 376 470 5.1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106475
AA Change: I42T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000102083
Gene: ENSMUSG00000034042
AA Change: I42T

DomainStartEndE-ValueType
low complexity region 204 219 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 289 320 N/A INTRINSIC
Pfam:Vasculin 377 470 1.3e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 A T 12: 84,659,639 (GRCm39) F153I possibly damaging Het
Adcy1 G A 11: 7,094,765 (GRCm39) V564I probably damaging Het
Apol9b T C 15: 77,620,134 (GRCm39) I310T possibly damaging Het
Arhgef28 C A 13: 98,133,370 (GRCm39) V366F probably benign Het
B020004C17Rik C T 14: 57,254,773 (GRCm39) T199I possibly damaging Het
Carmil2 C T 8: 106,417,467 (GRCm39) T575I possibly damaging Het
Catsper1 A T 19: 5,386,691 (GRCm39) Q308L unknown Het
Cpa2 T A 6: 30,551,989 (GRCm39) S239T probably damaging Het
Cyrib A T 15: 63,810,507 (GRCm39) probably null Het
Ddit3 G A 10: 127,131,776 (GRCm39) G108D probably damaging Het
Dnah3 T C 7: 119,628,239 (GRCm39) I1473V probably benign Het
Dscam A G 16: 96,445,131 (GRCm39) V1520A probably benign Het
Edc4 TAGTAGCAGCAGCAGTAGCAGCAGCAG TAGTAGCAGCAGCAG 8: 106,615,037 (GRCm39) probably benign Het
Ednrb T A 14: 104,057,453 (GRCm39) I370F probably benign Het
Ehd3 A G 17: 74,134,457 (GRCm39) E272G possibly damaging Het
Epha7 C T 4: 28,871,937 (GRCm39) S422L probably benign Het
Fkbp11 T C 15: 98,622,307 (GRCm39) K189E unknown Het
Frem1 T A 4: 82,884,381 (GRCm39) E1190D probably benign Het
Gabrg2 A C 11: 41,867,390 (GRCm39) Y76* probably null Het
Gm11437 T A 11: 84,058,298 (GRCm39) probably benign Het
Gm8947 C A 1: 151,068,847 (GRCm39) Q227K probably benign Het
Gm9195 A G 14: 72,717,496 (GRCm39) F279S probably damaging Het
Hdac5 A T 11: 102,088,207 (GRCm39) V939E probably null Het
Hivep3 CGG CG 4: 119,955,108 (GRCm39) 1141 probably null Het
Kitl A T 10: 99,851,943 (GRCm39) I21F probably benign Het
Krt1 T C 15: 101,755,307 (GRCm39) D484G probably damaging Het
Larp1 C A 11: 57,938,904 (GRCm39) P527T probably damaging Het
Lrp5 A G 19: 3,670,085 (GRCm39) V673A possibly damaging Het
Lrp6 G T 6: 134,427,781 (GRCm39) P1604T probably damaging Het
Mmp27 G A 9: 7,577,318 (GRCm39) V228M probably damaging Het
Ms4a6d G A 19: 11,567,437 (GRCm39) Q155* probably null Het
Myo15a G T 11: 60,381,741 (GRCm39) probably null Het
Myt1 A G 2: 181,424,384 (GRCm39) K26E possibly damaging Het
Nek1 T A 8: 61,542,741 (GRCm39) I777N probably benign Het
Nlrc5 C T 8: 95,203,021 (GRCm39) R374* probably null Het
Nol8 T C 13: 49,814,695 (GRCm39) S268P probably benign Het
Nynrin T A 14: 56,107,968 (GRCm39) L1025Q probably damaging Het
Or8h9 A G 2: 86,789,602 (GRCm39) S67P probably damaging Het
Osbpl3 A T 6: 50,325,078 (GRCm39) L140H probably damaging Het
Pcnt T C 10: 76,235,835 (GRCm39) N1382S probably benign Het
Pef1 T A 4: 130,021,178 (GRCm39) L244* probably null Het
Phf11a T C 14: 59,518,174 (GRCm39) E191G probably benign Het
Polr3a A T 14: 24,517,144 (GRCm39) D702E probably damaging Het
Ptch1 C T 13: 63,659,798 (GRCm39) G1285D probably benign Het
Ptpn3 T C 4: 57,221,993 (GRCm39) D566G probably damaging Het
Pwp2 C T 10: 78,018,314 (GRCm39) G126R probably damaging Het
Scgb1b12 T C 7: 32,033,992 (GRCm39) I84T probably damaging Het
Sh2b1 A T 7: 126,067,685 (GRCm39) D618E possibly damaging Het
Slc35f5 T A 1: 125,512,256 (GRCm39) V352E probably damaging Het
Sppl2c A G 11: 104,078,430 (GRCm39) E410G probably damaging Het
St6galnac2 T C 11: 116,570,805 (GRCm39) Y261C probably damaging Het
Stra6 G A 9: 58,058,543 (GRCm39) R468Q probably benign Het
Taf3 T C 2: 9,921,188 (GRCm39) H924R unknown Het
Tbx18 C A 9: 87,612,750 (GRCm39) V50L probably benign Het
Tgoln1 G C 6: 72,593,261 (GRCm39) T73R probably benign Het
Unc45b C T 11: 82,833,321 (GRCm39) T845I probably benign Het
Usp15 T C 10: 123,032,798 (GRCm39) D8G possibly damaging Het
Vmn2r91 A G 17: 18,356,540 (GRCm39) I736V possibly damaging Het
Vps13c C A 9: 67,821,355 (GRCm39) D1288E probably benign Het
Zfp458 T A 13: 67,405,300 (GRCm39) M380L probably benign Het
Zfp638 A G 6: 83,906,437 (GRCm39) N201D possibly damaging Het
Other mutations in Gpbp1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Gpbp1l1 APN 4 116,444,710 (GRCm39) critical splice donor site probably null
IGL03342:Gpbp1l1 APN 4 116,431,740 (GRCm39) missense probably benign
R0534:Gpbp1l1 UTSW 4 116,448,465 (GRCm39) missense probably damaging 1.00
R0964:Gpbp1l1 UTSW 4 116,438,436 (GRCm39) splice site probably benign
R1136:Gpbp1l1 UTSW 4 116,450,115 (GRCm39) missense probably damaging 1.00
R1169:Gpbp1l1 UTSW 4 116,431,563 (GRCm39) missense possibly damaging 0.53
R3975:Gpbp1l1 UTSW 4 116,428,182 (GRCm39) critical splice donor site probably null
R4296:Gpbp1l1 UTSW 4 116,444,656 (GRCm39) missense possibly damaging 0.80
R4676:Gpbp1l1 UTSW 4 116,447,462 (GRCm39) missense probably damaging 1.00
R4870:Gpbp1l1 UTSW 4 116,430,714 (GRCm39) missense probably benign
R5086:Gpbp1l1 UTSW 4 116,445,789 (GRCm39) missense probably benign 0.04
R5931:Gpbp1l1 UTSW 4 116,447,457 (GRCm39) missense probably benign 0.00
R6486:Gpbp1l1 UTSW 4 116,438,572 (GRCm39) missense probably damaging 0.99
R6604:Gpbp1l1 UTSW 4 116,430,702 (GRCm39) missense probably benign 0.09
R6973:Gpbp1l1 UTSW 4 116,438,479 (GRCm39) missense possibly damaging 0.53
R7031:Gpbp1l1 UTSW 4 116,450,045 (GRCm39) missense probably damaging 1.00
R7230:Gpbp1l1 UTSW 4 116,445,807 (GRCm39) missense probably damaging 0.99
R7286:Gpbp1l1 UTSW 4 116,447,442 (GRCm39) missense probably benign 0.02
R7791:Gpbp1l1 UTSW 4 116,431,617 (GRCm39) missense probably damaging 1.00
R9475:Gpbp1l1 UTSW 4 116,431,558 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GTAATCTGGTTATGATACTTCACATCT -3'
(R):5'- AAGCAGTAGTTCAAATATATGGTCAC -3'

Sequencing Primer
(F):5'- ATGTAGCTGGCCCCAAATTCATG -3'
(R):5'- CTGGTCTACAAGTGAGTTCCAGGAC -3'
Posted On 2019-09-13