Incidental Mutation 'R7368:Lrp6'
ID571924
Institutional Source Beutler Lab
Gene Symbol Lrp6
Ensembl Gene ENSMUSG00000030201
Gene Namelow density lipoprotein receptor-related protein 6
Synonymsskax26, Cd, ska26, ska
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R7368 (G1)
Quality Score108.008
Status Validated
Chromosome6
Chromosomal Location134446476-134566965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 134450818 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 1604 (P1604T)
Ref Sequence ENSEMBL: ENSMUSP00000032322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032322]
Predicted Effect probably damaging
Transcript: ENSMUST00000032322
AA Change: P1604T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032322
Gene: ENSMUSG00000030201
AA Change: P1604T

DomainStartEndE-ValueType
LY 43 85 1.55e-2 SMART
LY 87 129 1.91e-11 SMART
LY 130 173 5.19e-13 SMART
LY 174 216 1.39e-13 SMART
LY 217 258 2.87e-6 SMART
EGF 285 324 2.16e-1 SMART
low complexity region 330 341 N/A INTRINSIC
LY 352 394 1.29e-8 SMART
LY 395 437 5.73e-15 SMART
LY 438 481 1.07e-14 SMART
LY 482 524 3.07e-15 SMART
LY 525 565 4.66e-6 SMART
EGF 591 628 1.47e-3 SMART
LY 654 696 2.06e-7 SMART
LY 697 739 3.73e-14 SMART
LY 740 783 3.37e-12 SMART
LY 784 825 1.17e-6 SMART
LY 827 865 1.91e-2 SMART
EGF 892 930 7.35e-4 SMART
LY 957 999 1.41e-5 SMART
LY 1005 1048 5.32e-1 SMART
LY 1049 1093 5e-6 SMART
LY 1094 1136 4.25e-9 SMART
LY 1137 1177 1.91e-2 SMART
EGF 1206 1250 1.23e1 SMART
LDLa 1248 1287 2.42e-12 SMART
LDLa 1288 1324 4.37e-10 SMART
LDLa 1325 1362 1.66e-10 SMART
transmembrane domain 1371 1393 N/A INTRINSIC
low complexity region 1429 1438 N/A INTRINSIC
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1508 1524 N/A INTRINSIC
low complexity region 1566 1573 N/A INTRINSIC
low complexity region 1596 1608 N/A INTRINSIC
Meta Mutation Damage Score 0.1468 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.[provided by RefSeq, Dec 2009]
PHENOTYPE: Animals homozygous for this mutation exhibit partial embryonic lethality, growth retardation, crooked tail, abnormal vertebrae, small skull with occasional bent nose, absence of the third molars and small and/or unerupted lower incisors. Heterozygotes exhibit a crooked tail and abnormal vertebrae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 A T 12: 84,612,865 F153I possibly damaging Het
Adcy1 G A 11: 7,144,765 V564I probably damaging Het
Apol9b T C 15: 77,735,934 I310T possibly damaging Het
Arhgef28 C A 13: 97,996,862 V366F probably benign Het
B020004C17Rik C T 14: 57,017,316 T199I possibly damaging Het
Carmil2 C T 8: 105,690,835 T575I possibly damaging Het
Catsper1 A T 19: 5,336,663 Q308L unknown Het
Cpa2 T A 6: 30,551,990 S239T probably damaging Het
Ddit3 G A 10: 127,295,907 G108D probably damaging Het
Dnah3 T C 7: 120,029,016 I1473V probably benign Het
Dscam A G 16: 96,643,931 V1520A probably benign Het
Edc4 TAGTAGCAGCAGCAGTAGCAGCAGCAG TAGTAGCAGCAGCAG 8: 105,888,405 probably benign Het
Ednrb T A 14: 103,820,017 I370F probably benign Het
Ehd3 A G 17: 73,827,462 E272G possibly damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam49b A T 15: 63,938,658 probably null Het
Fkbp11 T C 15: 98,724,426 K189E unknown Het
Frem1 T A 4: 82,966,144 E1190D probably benign Het
Gabrg2 A C 11: 41,976,563 Y76* probably null Het
Gm11437 T A 11: 84,167,472 probably benign Het
Gm8947 C A 1: 151,193,096 Q227K probably benign Het
Gm9195 A G 14: 72,480,056 F279S probably damaging Het
Gpbp1l1 T C 4: 116,573,458 I42T probably benign Het
Hdac5 A T 11: 102,197,381 V939E probably null Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kitl A T 10: 100,016,081 I21F probably benign Het
Krt1 T C 15: 101,846,872 D484G probably damaging Het
Larp1 C A 11: 58,048,078 P527T probably damaging Het
Lrp5 A G 19: 3,620,085 V673A possibly damaging Het
Mmp27 G A 9: 7,577,317 V228M probably damaging Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo15 G T 11: 60,490,915 probably null Het
Myt1 A G 2: 181,782,591 K26E possibly damaging Het
Nek1 T A 8: 61,089,707 I777N probably benign Het
Nlrc5 C T 8: 94,476,393 R374* probably null Het
Nol8 T C 13: 49,661,219 S268P probably benign Het
Nynrin T A 14: 55,870,511 L1025Q probably damaging Het
Olfr1099 A G 2: 86,959,258 S67P probably damaging Het
Osbpl3 A T 6: 50,348,098 L140H probably damaging Het
Pcnt T C 10: 76,400,001 N1382S probably benign Het
Pef1 T A 4: 130,127,385 L244* probably null Het
Phf11a T C 14: 59,280,725 E191G probably benign Het
Polr3a A T 14: 24,467,076 D702E probably damaging Het
Ptch1 C T 13: 63,511,984 G1285D probably benign Het
Ptpn3 T C 4: 57,221,993 D566G probably damaging Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
Scgb1b12 T C 7: 32,334,567 I84T probably damaging Het
Sh2b1 A T 7: 126,468,513 D618E possibly damaging Het
Slc35f5 T A 1: 125,584,519 V352E probably damaging Het
Sppl2c A G 11: 104,187,604 E410G probably damaging Het
St6galnac2 T C 11: 116,679,979 Y261C probably damaging Het
Stra6 G A 9: 58,151,260 R468Q probably benign Het
Taf3 T C 2: 9,916,377 H924R unknown Het
Tbx18 C A 9: 87,730,697 V50L probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Unc45b C T 11: 82,942,495 T845I probably benign Het
Usp15 T C 10: 123,196,893 D8G possibly damaging Het
Vmn2r91 A G 17: 18,136,278 I736V possibly damaging Het
Vps13c C A 9: 67,914,073 D1288E probably benign Het
Zfp458 T A 13: 67,257,236 M380L probably benign Het
Zfp638 A G 6: 83,929,455 N201D possibly damaging Het
Other mutations in Lrp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Lrp6 APN 6 134456090 missense probably benign 0.17
IGL00765:Lrp6 APN 6 134541854 missense probably benign 0.02
IGL00898:Lrp6 APN 6 134479739 missense probably damaging 0.99
IGL00916:Lrp6 APN 6 134484289 missense probably damaging 1.00
IGL00961:Lrp6 APN 6 134507646 missense probably damaging 0.98
IGL01620:Lrp6 APN 6 134511262 missense probably damaging 1.00
IGL01765:Lrp6 APN 6 134456145 missense probably damaging 0.99
IGL02066:Lrp6 APN 6 134450937 nonsense probably null
IGL02067:Lrp6 APN 6 134480396 missense probably damaging 0.99
IGL02169:Lrp6 APN 6 134513327 missense probably damaging 0.96
IGL02281:Lrp6 APN 6 134457734 missense probably benign 0.40
IGL02484:Lrp6 APN 6 134541923 missense probably benign 0.15
IGL02724:Lrp6 APN 6 134484265 missense probably damaging 1.00
IGL02876:Lrp6 APN 6 134456114 missense probably benign 0.43
IGL03011:Lrp6 APN 6 134520417 missense possibly damaging 0.80
IGL03352:Lrp6 APN 6 134479763 missense probably damaging 1.00
Coiled UTSW 6 134507558 nonsense probably null
PIT4494001:Lrp6 UTSW 6 134479778 missense probably damaging 1.00
R0008:Lrp6 UTSW 6 134485753 missense probably damaging 0.96
R0008:Lrp6 UTSW 6 134485753 missense probably damaging 0.96
R0201:Lrp6 UTSW 6 134450897 nonsense probably null
R0295:Lrp6 UTSW 6 134457693 missense probably benign 0.02
R0370:Lrp6 UTSW 6 134479766 missense probably damaging 1.00
R0382:Lrp6 UTSW 6 134467668 missense probably damaging 1.00
R0413:Lrp6 UTSW 6 134507624 missense probably damaging 0.99
R0468:Lrp6 UTSW 6 134485661 missense possibly damaging 0.94
R0492:Lrp6 UTSW 6 134480518 missense possibly damaging 0.58
R0584:Lrp6 UTSW 6 134456076 missense probably damaging 0.99
R0631:Lrp6 UTSW 6 134479775 missense possibly damaging 0.95
R0738:Lrp6 UTSW 6 134542045 missense probably benign 0.13
R0907:Lrp6 UTSW 6 134507525 missense probably damaging 0.96
R1273:Lrp6 UTSW 6 134467507 critical splice donor site probably null
R1548:Lrp6 UTSW 6 134459429 missense possibly damaging 0.89
R1639:Lrp6 UTSW 6 134453566 missense possibly damaging 0.68
R1650:Lrp6 UTSW 6 134468769 missense probably benign 0.01
R1696:Lrp6 UTSW 6 134468723 missense probably damaging 1.00
R1751:Lrp6 UTSW 6 134464568 missense probably damaging 1.00
R1780:Lrp6 UTSW 6 134464451 missense probably damaging 0.99
R2013:Lrp6 UTSW 6 134480374 critical splice donor site probably null
R2015:Lrp6 UTSW 6 134480374 critical splice donor site probably null
R2165:Lrp6 UTSW 6 134459283 missense probably damaging 1.00
R2294:Lrp6 UTSW 6 134457742 missense probably damaging 1.00
R2336:Lrp6 UTSW 6 134507583 missense probably damaging 0.97
R2964:Lrp6 UTSW 6 134467526 missense probably damaging 1.00
R3716:Lrp6 UTSW 6 134507447 missense probably damaging 1.00
R4017:Lrp6 UTSW 6 134520550 missense probably damaging 1.00
R4370:Lrp6 UTSW 6 134506358 nonsense probably null
R4521:Lrp6 UTSW 6 134485862 missense probably damaging 1.00
R4573:Lrp6 UTSW 6 134470730 nonsense probably null
R4645:Lrp6 UTSW 6 134484250 missense probably damaging 1.00
R4661:Lrp6 UTSW 6 134511267 missense probably benign
R4688:Lrp6 UTSW 6 134479743 missense probably damaging 1.00
R4784:Lrp6 UTSW 6 134479539 missense probably benign 0.06
R5236:Lrp6 UTSW 6 134511264 missense probably damaging 1.00
R5506:Lrp6 UTSW 6 134459296 missense probably benign 0.09
R5508:Lrp6 UTSW 6 134464516 missense probably benign 0.31
R6001:Lrp6 UTSW 6 134464518 missense probably benign 0.03
R6319:Lrp6 UTSW 6 134541835 missense possibly damaging 0.46
R6537:Lrp6 UTSW 6 134480495 missense probably benign
R6552:Lrp6 UTSW 6 134454729 missense probably benign 0.17
R6559:Lrp6 UTSW 6 134513254 missense probably damaging 1.00
R6575:Lrp6 UTSW 6 134541971 missense possibly damaging 0.80
R6585:Lrp6 UTSW 6 134507558 nonsense probably null
R6700:Lrp6 UTSW 6 134479560 missense probably damaging 1.00
R6724:Lrp6 UTSW 6 134486541 missense possibly damaging 0.94
R7159:Lrp6 UTSW 6 134507551 missense probably benign
R7266:Lrp6 UTSW 6 134507401 missense probably damaging 1.00
R7339:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7341:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7342:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7348:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7359:Lrp6 UTSW 6 134450960 nonsense probably null
R7366:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7501:Lrp6 UTSW 6 134486508 missense probably damaging 1.00
R7548:Lrp6 UTSW 6 134507508 missense probably damaging 0.97
R7652:Lrp6 UTSW 6 134511245 nonsense probably null
R7771:Lrp6 UTSW 6 134462616 missense probably damaging 1.00
Z1176:Lrp6 UTSW 6 134456157 missense possibly damaging 0.72
Z1177:Lrp6 UTSW 6 134462541 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGTACAAATATCTCCAGCACC -3'
(R):5'- GCAGCACTGATGTCTGTGAC -3'

Sequencing Primer
(F):5'- ACCCACCCACTTTATAATGTTAACTG -3'
(R):5'- GTGACAGTGACTATGCTCCTAGC -3'
Posted On2019-09-13