Incidental Mutation 'R7368:Dnah3'
ID571926
Institutional Source Beutler Lab
Gene Symbol Dnah3
Ensembl Gene ENSMUSG00000052273
Gene Namedynein, axonemal, heavy chain 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R7368 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location119922671-120095280 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120029016 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1473 (I1473V)
Ref Sequence ENSEMBL: ENSMUSP00000042857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046993] [ENSMUST00000209154] [ENSMUST00000213149]
Predicted Effect probably benign
Transcript: ENSMUST00000046993
AA Change: I1473V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042857
Gene: ENSMUSG00000052273
AA Change: I1473V

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
Pfam:DHC_N2 826 1235 3.3e-144 PFAM
AAA 1388 1527 1.59e-1 SMART
low complexity region 1594 1606 N/A INTRINSIC
Blast:AAA 1669 1897 9e-84 BLAST
AAA 2033 2180 1.33e-3 SMART
Pfam:AAA_8 2362 2632 1.5e-63 PFAM
Pfam:MT 2644 2994 7.4e-52 PFAM
Pfam:AAA_9 3015 3240 3.5e-92 PFAM
low complexity region 3338 3349 N/A INTRINSIC
Pfam:Dynein_heavy 3376 4079 4.4e-285 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209154
AA Change: I1462V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000213149
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 A T 12: 84,612,865 F153I possibly damaging Het
Adcy1 G A 11: 7,144,765 V564I probably damaging Het
Apol9b T C 15: 77,735,934 I310T possibly damaging Het
Arhgef28 C A 13: 97,996,862 V366F probably benign Het
B020004C17Rik C T 14: 57,017,316 T199I possibly damaging Het
Carmil2 C T 8: 105,690,835 T575I possibly damaging Het
Catsper1 A T 19: 5,336,663 Q308L unknown Het
Cpa2 T A 6: 30,551,990 S239T probably damaging Het
Ddit3 G A 10: 127,295,907 G108D probably damaging Het
Dscam A G 16: 96,643,931 V1520A probably benign Het
Edc4 TAGTAGCAGCAGCAGTAGCAGCAGCAG TAGTAGCAGCAGCAG 8: 105,888,405 probably benign Het
Ednrb T A 14: 103,820,017 I370F probably benign Het
Ehd3 A G 17: 73,827,462 E272G possibly damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam49b A T 15: 63,938,658 probably null Het
Fkbp11 T C 15: 98,724,426 K189E unknown Het
Frem1 T A 4: 82,966,144 E1190D probably benign Het
Gabrg2 A C 11: 41,976,563 Y76* probably null Het
Gm11437 T A 11: 84,167,472 probably benign Het
Gm8947 C A 1: 151,193,096 Q227K probably benign Het
Gm9195 A G 14: 72,480,056 F279S probably damaging Het
Gpbp1l1 T C 4: 116,573,458 I42T probably benign Het
Hdac5 A T 11: 102,197,381 V939E probably null Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kitl A T 10: 100,016,081 I21F probably benign Het
Krt1 T C 15: 101,846,872 D484G probably damaging Het
Larp1 C A 11: 58,048,078 P527T probably damaging Het
Lrp5 A G 19: 3,620,085 V673A possibly damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Mmp27 G A 9: 7,577,317 V228M probably damaging Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo15 G T 11: 60,490,915 probably null Het
Myt1 A G 2: 181,782,591 K26E possibly damaging Het
Nek1 T A 8: 61,089,707 I777N probably benign Het
Nlrc5 C T 8: 94,476,393 R374* probably null Het
Nol8 T C 13: 49,661,219 S268P probably benign Het
Nynrin T A 14: 55,870,511 L1025Q probably damaging Het
Olfr1099 A G 2: 86,959,258 S67P probably damaging Het
Osbpl3 A T 6: 50,348,098 L140H probably damaging Het
Pcnt T C 10: 76,400,001 N1382S probably benign Het
Pef1 T A 4: 130,127,385 L244* probably null Het
Phf11a T C 14: 59,280,725 E191G probably benign Het
Polr3a A T 14: 24,467,076 D702E probably damaging Het
Ptch1 C T 13: 63,511,984 G1285D probably benign Het
Ptpn3 T C 4: 57,221,993 D566G probably damaging Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
Scgb1b12 T C 7: 32,334,567 I84T probably damaging Het
Sh2b1 A T 7: 126,468,513 D618E possibly damaging Het
Slc35f5 T A 1: 125,584,519 V352E probably damaging Het
Sppl2c A G 11: 104,187,604 E410G probably damaging Het
St6galnac2 T C 11: 116,679,979 Y261C probably damaging Het
Stra6 G A 9: 58,151,260 R468Q probably benign Het
Taf3 T C 2: 9,916,377 H924R unknown Het
Tbx18 C A 9: 87,730,697 V50L probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Unc45b C T 11: 82,942,495 T845I probably benign Het
Usp15 T C 10: 123,196,893 D8G possibly damaging Het
Vmn2r91 A G 17: 18,136,278 I736V possibly damaging Het
Vps13c C A 9: 67,914,073 D1288E probably benign Het
Zfp458 T A 13: 67,257,236 M380L probably benign Het
Zfp638 A G 6: 83,929,455 N201D possibly damaging Het
Other mutations in Dnah3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Dnah3 APN 7 119938905 missense possibly damaging 0.88
IGL01095:Dnah3 APN 7 119951597 missense probably benign 0.02
IGL01329:Dnah3 APN 7 120022941 missense probably damaging 1.00
IGL01380:Dnah3 APN 7 119926564 missense probably damaging 1.00
IGL01410:Dnah3 APN 7 119967720 missense possibly damaging 0.91
IGL01487:Dnah3 APN 7 119965530 nonsense probably null
IGL01843:Dnah3 APN 7 119943575 missense probably benign 0.12
IGL01929:Dnah3 APN 7 119951651 nonsense probably null
IGL01994:Dnah3 APN 7 119951214 missense possibly damaging 0.58
IGL02115:Dnah3 APN 7 120029054 missense probably damaging 1.00
IGL02273:Dnah3 APN 7 119951271 missense probably damaging 1.00
IGL02299:Dnah3 APN 7 119967579 missense probably benign 0.39
IGL02421:Dnah3 APN 7 119950992 missense possibly damaging 0.87
IGL02514:Dnah3 APN 7 119966247 missense probably damaging 1.00
IGL02596:Dnah3 APN 7 119938914 missense probably benign 0.19
IGL02716:Dnah3 APN 7 119937023 missense probably damaging 0.97
IGL02738:Dnah3 APN 7 119965497 missense probably benign
IGL03404:Dnah3 APN 7 119938977 missense probably damaging 1.00
BB004:Dnah3 UTSW 7 119951271 missense probably damaging 0.97
BB014:Dnah3 UTSW 7 119951271 missense probably damaging 0.97
R0011:Dnah3 UTSW 7 120019701 missense probably damaging 1.00
R0195:Dnah3 UTSW 7 120077775 critical splice donor site probably null
R0241:Dnah3 UTSW 7 119922730 missense probably damaging 1.00
R0241:Dnah3 UTSW 7 119922730 missense probably damaging 1.00
R0312:Dnah3 UTSW 7 120045659 missense probably damaging 1.00
R0316:Dnah3 UTSW 7 119965659 missense possibly damaging 0.94
R0370:Dnah3 UTSW 7 120086720 missense possibly damaging 0.91
R0426:Dnah3 UTSW 7 119943572 missense probably benign 0.11
R0525:Dnah3 UTSW 7 119928754 missense probably damaging 1.00
R0625:Dnah3 UTSW 7 120071887 missense possibly damaging 0.68
R0627:Dnah3 UTSW 7 120020915 missense probably damaging 1.00
R0632:Dnah3 UTSW 7 119967905 missense probably benign 0.11
R0928:Dnah3 UTSW 7 120030051 missense probably damaging 1.00
R0964:Dnah3 UTSW 7 119952739 splice site probably benign
R0972:Dnah3 UTSW 7 120035340 splice site probably null
R1066:Dnah3 UTSW 7 120061009 missense probably damaging 1.00
R1082:Dnah3 UTSW 7 120078445 missense probably damaging 1.00
R1127:Dnah3 UTSW 7 119923030 missense probably damaging 1.00
R1132:Dnah3 UTSW 7 119939004 missense possibly damaging 0.50
R1222:Dnah3 UTSW 7 120090676 missense probably benign 0.28
R1420:Dnah3 UTSW 7 119951979 missense probably damaging 0.99
R1456:Dnah3 UTSW 7 120047630 missense probably damaging 1.00
R1472:Dnah3 UTSW 7 120070958 missense probably benign 0.12
R1617:Dnah3 UTSW 7 120089946 missense probably benign 0.01
R1624:Dnah3 UTSW 7 120019695 missense probably damaging 0.99
R1654:Dnah3 UTSW 7 119926449 missense probably damaging 1.00
R1673:Dnah3 UTSW 7 119971179 nonsense probably null
R1677:Dnah3 UTSW 7 119928740 missense probably damaging 1.00
R1687:Dnah3 UTSW 7 120045786 splice site probably null
R1711:Dnah3 UTSW 7 120078571 missense probably damaging 1.00
R1738:Dnah3 UTSW 7 120035359 missense probably damaging 1.00
R1778:Dnah3 UTSW 7 120078402 missense probably damaging 1.00
R1866:Dnah3 UTSW 7 119928856 splice site probably null
R1883:Dnah3 UTSW 7 120077919 missense probably benign 0.06
R1894:Dnah3 UTSW 7 120086334 missense probably benign 0.05
R1929:Dnah3 UTSW 7 119975129 missense probably benign 0.10
R1988:Dnah3 UTSW 7 119967570 missense possibly damaging 0.92
R1988:Dnah3 UTSW 7 119967959 missense probably damaging 0.99
R2010:Dnah3 UTSW 7 120095177 start codon destroyed probably benign 0.00
R2022:Dnah3 UTSW 7 119951242 missense probably damaging 1.00
R2026:Dnah3 UTSW 7 120039406 missense probably damaging 1.00
R2063:Dnah3 UTSW 7 119951909 missense probably damaging 0.96
R2131:Dnah3 UTSW 7 119967759 missense possibly damaging 0.93
R2152:Dnah3 UTSW 7 119952013 missense probably benign 0.02
R2199:Dnah3 UTSW 7 119951569 missense possibly damaging 0.89
R2271:Dnah3 UTSW 7 119975129 missense probably benign 0.10
R2350:Dnah3 UTSW 7 120045788 splice site probably null
R2567:Dnah3 UTSW 7 119952697 missense possibly damaging 0.83
R2848:Dnah3 UTSW 7 119967938 missense probably benign 0.01
R2902:Dnah3 UTSW 7 119951499 missense possibly damaging 0.61
R2926:Dnah3 UTSW 7 119951115 missense probably damaging 1.00
R2944:Dnah3 UTSW 7 119951110 missense probably damaging 1.00
R3022:Dnah3 UTSW 7 120078481 missense possibly damaging 0.93
R3401:Dnah3 UTSW 7 119967656 missense probably benign 0.00
R3402:Dnah3 UTSW 7 119967656 missense probably benign 0.00
R3403:Dnah3 UTSW 7 119967656 missense probably benign 0.00
R3919:Dnah3 UTSW 7 119951080 missense probably damaging 1.00
R3972:Dnah3 UTSW 7 120086720 missense probably damaging 0.99
R4162:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4184:Dnah3 UTSW 7 120083293 missense probably damaging 1.00
R4198:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4199:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4200:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4239:Dnah3 UTSW 7 120029025 nonsense probably null
R4478:Dnah3 UTSW 7 120071863 missense probably benign 0.00
R4579:Dnah3 UTSW 7 120009331 missense probably damaging 1.00
R4600:Dnah3 UTSW 7 120089946 missense probably benign
R4649:Dnah3 UTSW 7 120047698 missense probably damaging 1.00
R4658:Dnah3 UTSW 7 119950651 missense probably damaging 1.00
R4728:Dnah3 UTSW 7 120059366 missense probably damaging 0.99
R4739:Dnah3 UTSW 7 120077946 missense possibly damaging 0.54
R4758:Dnah3 UTSW 7 120079406 missense probably benign 0.00
R4785:Dnah3 UTSW 7 119967824 missense probably benign 0.29
R4789:Dnah3 UTSW 7 120011072 missense probably damaging 1.00
R4930:Dnah3 UTSW 7 119951681 nonsense probably null
R4935:Dnah3 UTSW 7 120016477 nonsense probably null
R4946:Dnah3 UTSW 7 119931560 missense probably damaging 1.00
R4981:Dnah3 UTSW 7 119956201 missense probably benign 0.03
R4984:Dnah3 UTSW 7 119928779 missense probably benign 0.04
R5025:Dnah3 UTSW 7 120071905 missense probably benign 0.02
R5046:Dnah3 UTSW 7 119951580 missense probably damaging 1.00
R5056:Dnah3 UTSW 7 120020946 missense probably damaging 1.00
R5068:Dnah3 UTSW 7 120032790 missense probably benign
R5069:Dnah3 UTSW 7 120032790 missense probably benign
R5154:Dnah3 UTSW 7 119952419 missense probably damaging 1.00
R5208:Dnah3 UTSW 7 120032638 missense probably damaging 1.00
R5323:Dnah3 UTSW 7 120021011 missense probably damaging 1.00
R5330:Dnah3 UTSW 7 119943648 missense probably benign 0.00
R5385:Dnah3 UTSW 7 119924903 missense probably damaging 1.00
R5391:Dnah3 UTSW 7 120090076 missense probably benign 0.02
R5564:Dnah3 UTSW 7 119971466 critical splice donor site probably null
R5594:Dnah3 UTSW 7 119971621 missense possibly damaging 0.89
R5610:Dnah3 UTSW 7 119939065 splice site probably null
R5673:Dnah3 UTSW 7 119951589 missense possibly damaging 0.91
R5678:Dnah3 UTSW 7 120077851 missense probably benign 0.00
R5737:Dnah3 UTSW 7 120059198 missense probably benign 0.03
R5766:Dnah3 UTSW 7 119978222 missense probably damaging 1.00
R5769:Dnah3 UTSW 7 120089952 nonsense probably null
R5789:Dnah3 UTSW 7 119943599 missense possibly damaging 0.70
R5791:Dnah3 UTSW 7 119931473 missense probably benign 0.00
R5841:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5843:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5844:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5846:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5851:Dnah3 UTSW 7 120039362 missense possibly damaging 0.51
R5853:Dnah3 UTSW 7 119938833 missense probably damaging 1.00
R5857:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5865:Dnah3 UTSW 7 119975108 missense probably benign 0.00
R5885:Dnah3 UTSW 7 120069704 missense probably benign 0.10
R5898:Dnah3 UTSW 7 120078501 missense probably benign 0.37
R5917:Dnah3 UTSW 7 120016526 missense probably damaging 1.00
R5964:Dnah3 UTSW 7 119922880 missense probably benign 0.00
R5990:Dnah3 UTSW 7 120073541 missense probably benign
R6004:Dnah3 UTSW 7 120086297 missense probably benign 0.10
R6033:Dnah3 UTSW 7 120071647 missense probably benign 0.00
R6033:Dnah3 UTSW 7 120071647 missense probably benign 0.00
R6045:Dnah3 UTSW 7 119967522 missense probably damaging 0.99
R6056:Dnah3 UTSW 7 120030031 missense probably damaging 1.00
R6133:Dnah3 UTSW 7 120086246 missense probably benign 0.10
R6229:Dnah3 UTSW 7 119965488 missense probably benign 0.11
R6237:Dnah3 UTSW 7 120009384 missense probably damaging 1.00
R6333:Dnah3 UTSW 7 120054633 missense probably damaging 1.00
R6408:Dnah3 UTSW 7 119922968 splice site probably null
R6447:Dnah3 UTSW 7 119923054 missense probably benign 0.12
R6606:Dnah3 UTSW 7 120060956 missense probably benign 0.02
R6666:Dnah3 UTSW 7 120070949 missense probably benign 0.16
R6733:Dnah3 UTSW 7 119922974 missense probably benign 0.22
R6815:Dnah3 UTSW 7 119971727 missense probably benign
R6882:Dnah3 UTSW 7 119971184 missense possibly damaging 0.95
R6934:Dnah3 UTSW 7 120054601 critical splice donor site probably null
R6966:Dnah3 UTSW 7 120032754 missense probably damaging 1.00
R7025:Dnah3 UTSW 7 120030010 missense possibly damaging 0.90
R7207:Dnah3 UTSW 7 119971089 missense probably damaging 1.00
R7214:Dnah3 UTSW 7 119922742 missense probably damaging 1.00
R7222:Dnah3 UTSW 7 120071523 missense probably benign 0.00
R7235:Dnah3 UTSW 7 120032670 missense probably damaging 1.00
R7241:Dnah3 UTSW 7 119943633 missense probably benign 0.03
R7313:Dnah3 UTSW 7 119981344 missense probably benign 0.39
R7342:Dnah3 UTSW 7 120029985 missense probably damaging 1.00
R7375:Dnah3 UTSW 7 119951677 missense probably damaging 1.00
R7395:Dnah3 UTSW 7 119966251 missense
R7395:Dnah3 UTSW 7 120060960 missense probably benign 0.00
R7431:Dnah3 UTSW 7 120051744 missense probably damaging 1.00
R7499:Dnah3 UTSW 7 120060912 missense probably damaging 0.99
R7515:Dnah3 UTSW 7 120073592 missense probably benign 0.21
R7564:Dnah3 UTSW 7 119971594 missense probably benign
R7618:Dnah3 UTSW 7 119978378 missense probably damaging 0.97
R7697:Dnah3 UTSW 7 119967434 missense
R7728:Dnah3 UTSW 7 119938828 missense probably damaging 1.00
R7757:Dnah3 UTSW 7 120071570 missense probably benign
R7757:Dnah3 UTSW 7 119971215 splice site probably null
R7774:Dnah3 UTSW 7 119951752 nonsense probably null
R7804:Dnah3 UTSW 7 119952618 missense probably damaging 1.00
R7804:Dnah3 UTSW 7 120011012 missense probably damaging 1.00
R7857:Dnah3 UTSW 7 119951704 missense probably damaging 1.00
R7871:Dnah3 UTSW 7 119967552 missense
R7903:Dnah3 UTSW 7 120042128 missense probably damaging 1.00
R7927:Dnah3 UTSW 7 119951271 missense probably damaging 0.97
R7989:Dnah3 UTSW 7 120077789 missense probably benign
R8142:Dnah3 UTSW 7 120060966 missense probably benign 0.00
R8164:Dnah3 UTSW 7 119967614 missense probably damaging 1.00
R8237:Dnah3 UTSW 7 119926413 missense probably benign 0.01
R8313:Dnah3 UTSW 7 119951152 missense probably benign 0.38
R8338:Dnah3 UTSW 7 120071881 missense probably benign 0.01
R8355:Dnah3 UTSW 7 119952208 missense probably damaging 1.00
R8408:Dnah3 UTSW 7 119952505 missense probably damaging 1.00
R8411:Dnah3 UTSW 7 120011030 missense probably damaging 1.00
R8455:Dnah3 UTSW 7 119952208 missense probably damaging 1.00
Z1088:Dnah3 UTSW 7 120010873 missense probably null 1.00
Z1088:Dnah3 UTSW 7 120086297 missense probably benign 0.00
Z1176:Dnah3 UTSW 7 119967803 missense
Z1177:Dnah3 UTSW 7 119967901 missense probably damaging 0.99
Z1177:Dnah3 UTSW 7 120007862 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTACTACTGGGCTGTCCATGAG -3'
(R):5'- AAGCCCTAATTCGTGGTCCTC -3'

Sequencing Primer
(F):5'- CATGAGATCTTCAGGGGCATAGTC -3'
(R):5'- CGTGGTCCTCATTTGGAATATAAAGC -3'
Posted On2019-09-13