Incidental Mutation 'R7368:Nlrc5'
ID571929
Institutional Source Beutler Lab
Gene Symbol Nlrc5
Ensembl Gene ENSMUSG00000074151
Gene NameNLR family, CARD domain containing 5
SynonymsAI451557
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7368 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location94434356-94527272 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 94476393 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 374 (R374*)
Ref Sequence ENSEMBL: ENSMUSP00000138322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053085] [ENSMUST00000182409] [ENSMUST00000211816]
PDB Structure
The solution NMR structure of the NLRC5 caspase recruitment domain (CARD) [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000053085
AA Change: R374*
SMART Domains Protein: ENSMUSP00000138322
Gene: ENSMUSG00000074151
AA Change: R374*

DomainStartEndE-ValueType
low complexity region 136 151 N/A INTRINSIC
Pfam:NACHT 223 386 1.8e-32 PFAM
LRR 716 743 6.89e1 SMART
LRR 744 771 9.86e1 SMART
LRR 772 796 1.22e2 SMART
LRR 844 870 2.16e2 SMART
LRR 871 898 1.76e-1 SMART
LRR 1006 1033 1.9e0 SMART
LRR 1034 1061 4.51e1 SMART
low complexity region 1141 1169 N/A INTRINSIC
LRR 1240 1267 2.67e1 SMART
LRR 1273 1295 1.22e1 SMART
low complexity region 1341 1351 N/A INTRINSIC
LRR 1519 1546 5.48e1 SMART
LRR 1547 1574 3.36e1 SMART
LRR 1575 1602 1.69e1 SMART
LRR 1603 1630 8.99e-1 SMART
LRR 1631 1654 5.26e0 SMART
LRR 1659 1686 2.81e0 SMART
LRR 1687 1714 1.6e-4 SMART
LRR 1715 1742 1.06e0 SMART
LRR 1743 1768 8e0 SMART
LRR 1793 1820 2.06e1 SMART
LRR 1821 1848 5.42e-2 SMART
LRR 1849 1876 3.54e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000182409
AA Change: R374*
Predicted Effect probably null
Transcript: ENSMUST00000211816
AA Change: R374*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the caspase recruitment domain-containing NLR family. This gene plays a role in cytokine response and antiviral immunity through its inhibition of NF-kappa-B activation and negative regulation of type I interferon signaling pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal cytokine production induced by virus and bacteria infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 A T 12: 84,612,865 F153I possibly damaging Het
Adcy1 G A 11: 7,144,765 V564I probably damaging Het
Apol9b T C 15: 77,735,934 I310T possibly damaging Het
Arhgef28 C A 13: 97,996,862 V366F probably benign Het
B020004C17Rik C T 14: 57,017,316 T199I possibly damaging Het
Carmil2 C T 8: 105,690,835 T575I possibly damaging Het
Catsper1 A T 19: 5,336,663 Q308L unknown Het
Cpa2 T A 6: 30,551,990 S239T probably damaging Het
Ddit3 G A 10: 127,295,907 G108D probably damaging Het
Dnah3 T C 7: 120,029,016 I1473V probably benign Het
Dscam A G 16: 96,643,931 V1520A probably benign Het
Edc4 TAGTAGCAGCAGCAGTAGCAGCAGCAG TAGTAGCAGCAGCAG 8: 105,888,405 probably benign Het
Ednrb T A 14: 103,820,017 I370F probably benign Het
Ehd3 A G 17: 73,827,462 E272G possibly damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam49b A T 15: 63,938,658 probably null Het
Fkbp11 T C 15: 98,724,426 K189E unknown Het
Frem1 T A 4: 82,966,144 E1190D probably benign Het
Gabrg2 A C 11: 41,976,563 Y76* probably null Het
Gm11437 T A 11: 84,167,472 probably benign Het
Gm8947 C A 1: 151,193,096 Q227K probably benign Het
Gm9195 A G 14: 72,480,056 F279S probably damaging Het
Gpbp1l1 T C 4: 116,573,458 I42T probably benign Het
Hdac5 A T 11: 102,197,381 V939E probably null Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kitl A T 10: 100,016,081 I21F probably benign Het
Krt1 T C 15: 101,846,872 D484G probably damaging Het
Larp1 C A 11: 58,048,078 P527T probably damaging Het
Lrp5 A G 19: 3,620,085 V673A possibly damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Mmp27 G A 9: 7,577,317 V228M probably damaging Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo15 G T 11: 60,490,915 probably null Het
Myt1 A G 2: 181,782,591 K26E possibly damaging Het
Nek1 T A 8: 61,089,707 I777N probably benign Het
Nol8 T C 13: 49,661,219 S268P probably benign Het
Nynrin T A 14: 55,870,511 L1025Q probably damaging Het
Olfr1099 A G 2: 86,959,258 S67P probably damaging Het
Osbpl3 A T 6: 50,348,098 L140H probably damaging Het
Pcnt T C 10: 76,400,001 N1382S probably benign Het
Pef1 T A 4: 130,127,385 L244* probably null Het
Phf11a T C 14: 59,280,725 E191G probably benign Het
Polr3a A T 14: 24,467,076 D702E probably damaging Het
Ptch1 C T 13: 63,511,984 G1285D probably benign Het
Ptpn3 T C 4: 57,221,993 D566G probably damaging Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
Scgb1b12 T C 7: 32,334,567 I84T probably damaging Het
Sh2b1 A T 7: 126,468,513 D618E possibly damaging Het
Slc35f5 T A 1: 125,584,519 V352E probably damaging Het
Sppl2c A G 11: 104,187,604 E410G probably damaging Het
St6galnac2 T C 11: 116,679,979 Y261C probably damaging Het
Stra6 G A 9: 58,151,260 R468Q probably benign Het
Taf3 T C 2: 9,916,377 H924R unknown Het
Tbx18 C A 9: 87,730,697 V50L probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Unc45b C T 11: 82,942,495 T845I probably benign Het
Usp15 T C 10: 123,196,893 D8G possibly damaging Het
Vmn2r91 A G 17: 18,136,278 I736V possibly damaging Het
Vps13c C A 9: 67,914,073 D1288E probably benign Het
Zfp458 T A 13: 67,257,236 M380L probably benign Het
Zfp638 A G 6: 83,929,455 N201D possibly damaging Het
Other mutations in Nlrc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Nlrc5 APN 8 94502211 splice site probably benign
IGL00232:Nlrc5 APN 8 94484623 critical splice donor site probably null
IGL00324:Nlrc5 APN 8 94521479 missense probably damaging 1.00
IGL02715:Nlrc5 APN 8 94474668 missense probably damaging 1.00
IGL02992:Nlrc5 APN 8 94506573 missense possibly damaging 0.69
IGL03095:Nlrc5 APN 8 94521908 splice site probably benign
IGL03389:Nlrc5 APN 8 94521474 missense probably damaging 1.00
IGL03406:Nlrc5 APN 8 94476855 missense probably benign 0.01
Cassis UTSW 8 94476393 nonsense probably null
cowberry UTSW 8 94491525 missense possibly damaging 0.83
lingon UTSW 8 94481860 missense probably damaging 1.00
R0037:Nlrc5 UTSW 8 94489535 missense probably benign 0.00
R0048:Nlrc5 UTSW 8 94474656 missense possibly damaging 0.81
R0092:Nlrc5 UTSW 8 94489594 splice site probably benign
R0506:Nlrc5 UTSW 8 94493125 splice site probably benign
R0548:Nlrc5 UTSW 8 94521783 missense probably null 0.09
R2014:Nlrc5 UTSW 8 94525510 splice site probably benign
R3051:Nlrc5 UTSW 8 94476715 missense probably benign 0.01
R3776:Nlrc5 UTSW 8 94472839 missense possibly damaging 0.48
R3837:Nlrc5 UTSW 8 94511301 splice site probably benign
R4012:Nlrc5 UTSW 8 94475992 missense possibly damaging 0.92
R4367:Nlrc5 UTSW 8 94476564 missense probably damaging 1.00
R4400:Nlrc5 UTSW 8 94494353 missense probably benign 0.08
R4469:Nlrc5 UTSW 8 94520839 missense probably damaging 1.00
R4561:Nlrc5 UTSW 8 94477146 missense probably damaging 1.00
R4584:Nlrc5 UTSW 8 94477275 missense probably damaging 0.96
R4758:Nlrc5 UTSW 8 94512328 missense possibly damaging 0.70
R4834:Nlrc5 UTSW 8 94505485 missense probably benign 0.00
R4896:Nlrc5 UTSW 8 94521216 unclassified probably benign
R5004:Nlrc5 UTSW 8 94521216 unclassified probably benign
R5018:Nlrc5 UTSW 8 94525452 missense probably damaging 1.00
R5115:Nlrc5 UTSW 8 94476819 missense possibly damaging 0.67
R5116:Nlrc5 UTSW 8 94481860 missense probably damaging 1.00
R5126:Nlrc5 UTSW 8 94474671 missense possibly damaging 0.95
R5148:Nlrc5 UTSW 8 94476693 missense probably damaging 1.00
R5224:Nlrc5 UTSW 8 94494316 missense probably benign 0.26
R5527:Nlrc5 UTSW 8 94490416 missense probably damaging 1.00
R5640:Nlrc5 UTSW 8 94475793 missense probably benign 0.02
R5705:Nlrc5 UTSW 8 94475757 missense probably benign 0.00
R5778:Nlrc5 UTSW 8 94479526 missense possibly damaging 0.66
R5830:Nlrc5 UTSW 8 94472914 missense probably damaging 1.00
R5850:Nlrc5 UTSW 8 94521047 missense probably benign 0.00
R5978:Nlrc5 UTSW 8 94488593 missense probably damaging 0.98
R6335:Nlrc5 UTSW 8 94502274 missense probably benign 0.01
R6372:Nlrc5 UTSW 8 94479750 missense probably damaging 0.98
R6486:Nlrc5 UTSW 8 94521299 splice site probably null
R6765:Nlrc5 UTSW 8 94490368 missense probably benign 0.20
R6861:Nlrc5 UTSW 8 94521229 unclassified probably benign
R6869:Nlrc5 UTSW 8 94521955 missense probably benign 0.00
R7134:Nlrc5 UTSW 8 94479722 missense probably damaging 0.99
R7204:Nlrc5 UTSW 8 94491525 missense possibly damaging 0.83
R7231:Nlrc5 UTSW 8 94521805 critical splice donor site probably null
R7309:Nlrc5 UTSW 8 94474042 missense probably benign 0.01
R7497:Nlrc5 UTSW 8 94521970 missense probably damaging 1.00
R7606:Nlrc5 UTSW 8 94477117 missense possibly damaging 0.67
R7611:Nlrc5 UTSW 8 94512648 critical splice donor site probably null
Z1088:Nlrc5 UTSW 8 94504464 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GCTCTCCATGCTGATTCTGTGG -3'
(R):5'- CCATCTGCAGGTACAACTGG -3'

Sequencing Primer
(F):5'- TGGGTACTGACAATGCAGGCTC -3'
(R):5'- CATCTGCAGGTACAACTGGGTTATG -3'
Posted On2019-09-13