Incidental Mutation 'R7368:Pwp2'
ID571937
Institutional Source Beutler Lab
Gene Symbol Pwp2
Ensembl Gene ENSMUSG00000032834
Gene NamePWP2 periodic tryptophan protein homolog (yeast)
SynonymsPwp2, Pwp2h, 6530411D08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.746) question?
Stock #R7368 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location78170909-78185149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 78182480 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 126 (G126R)
Ref Sequence ENSEMBL: ENSMUSP00000045812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000384] [ENSMUST00000042556]
Predicted Effect probably benign
Transcript: ENSMUST00000000384
SMART Domains Protein: ENSMUSP00000000384
Gene: ENSMUSG00000000374

DomainStartEndE-ValueType
Pfam:TRAPPC10 1016 1245 1.1e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000042556
AA Change: G126R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045812
Gene: ENSMUSG00000032834
AA Change: G126R

DomainStartEndE-ValueType
WD40 43 83 1.47e2 SMART
WD40 86 123 1.78e1 SMART
WD40 133 172 5.35e-1 SMART
WD40 177 216 8.29e-1 SMART
low complexity region 239 254 N/A INTRINSIC
WD40 273 316 1.9e2 SMART
WD40 319 359 4.44e0 SMART
WD40 362 401 7.44e-8 SMART
WD40 404 443 3.87e-6 SMART
WD40 446 487 5.7e1 SMART
WD40 490 529 1.28e-11 SMART
WD40 533 571 9.94e-1 SMART
WD40 594 633 4.95e0 SMART
WD40 692 729 2.21e1 SMART
Pfam:Utp12 771 875 9.4e-25 PFAM
low complexity region 890 902 N/A INTRINSIC
Meta Mutation Damage Score 0.2376 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 A T 12: 84,612,865 F153I possibly damaging Het
Adcy1 G A 11: 7,144,765 V564I probably damaging Het
Apol9b T C 15: 77,735,934 I310T possibly damaging Het
Arhgef28 C A 13: 97,996,862 V366F probably benign Het
B020004C17Rik C T 14: 57,017,316 T199I possibly damaging Het
Carmil2 C T 8: 105,690,835 T575I possibly damaging Het
Catsper1 A T 19: 5,336,663 Q308L unknown Het
Cpa2 T A 6: 30,551,990 S239T probably damaging Het
Ddit3 G A 10: 127,295,907 G108D probably damaging Het
Dnah3 T C 7: 120,029,016 I1473V probably benign Het
Dscam A G 16: 96,643,931 V1520A probably benign Het
Edc4 TAGTAGCAGCAGCAGTAGCAGCAGCAG TAGTAGCAGCAGCAG 8: 105,888,405 probably benign Het
Ednrb T A 14: 103,820,017 I370F probably benign Het
Ehd3 A G 17: 73,827,462 E272G possibly damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam49b A T 15: 63,938,658 probably null Het
Fkbp11 T C 15: 98,724,426 K189E unknown Het
Frem1 T A 4: 82,966,144 E1190D probably benign Het
Gabrg2 A C 11: 41,976,563 Y76* probably null Het
Gm11437 T A 11: 84,167,472 probably benign Het
Gm8947 C A 1: 151,193,096 Q227K probably benign Het
Gm9195 A G 14: 72,480,056 F279S probably damaging Het
Gpbp1l1 T C 4: 116,573,458 I42T probably benign Het
Hdac5 A T 11: 102,197,381 V939E probably null Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kitl A T 10: 100,016,081 I21F probably benign Het
Krt1 T C 15: 101,846,872 D484G probably damaging Het
Larp1 C A 11: 58,048,078 P527T probably damaging Het
Lrp5 A G 19: 3,620,085 V673A possibly damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Mmp27 G A 9: 7,577,317 V228M probably damaging Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo15 G T 11: 60,490,915 probably null Het
Myt1 A G 2: 181,782,591 K26E possibly damaging Het
Nek1 T A 8: 61,089,707 I777N probably benign Het
Nlrc5 C T 8: 94,476,393 R374* probably null Het
Nol8 T C 13: 49,661,219 S268P probably benign Het
Nynrin T A 14: 55,870,511 L1025Q probably damaging Het
Olfr1099 A G 2: 86,959,258 S67P probably damaging Het
Osbpl3 A T 6: 50,348,098 L140H probably damaging Het
Pcnt T C 10: 76,400,001 N1382S probably benign Het
Pef1 T A 4: 130,127,385 L244* probably null Het
Phf11a T C 14: 59,280,725 E191G probably benign Het
Polr3a A T 14: 24,467,076 D702E probably damaging Het
Ptch1 C T 13: 63,511,984 G1285D probably benign Het
Ptpn3 T C 4: 57,221,993 D566G probably damaging Het
Scgb1b12 T C 7: 32,334,567 I84T probably damaging Het
Sh2b1 A T 7: 126,468,513 D618E possibly damaging Het
Slc35f5 T A 1: 125,584,519 V352E probably damaging Het
Sppl2c A G 11: 104,187,604 E410G probably damaging Het
St6galnac2 T C 11: 116,679,979 Y261C probably damaging Het
Stra6 G A 9: 58,151,260 R468Q probably benign Het
Taf3 T C 2: 9,916,377 H924R unknown Het
Tbx18 C A 9: 87,730,697 V50L probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Unc45b C T 11: 82,942,495 T845I probably benign Het
Usp15 T C 10: 123,196,893 D8G possibly damaging Het
Vmn2r91 A G 17: 18,136,278 I736V possibly damaging Het
Vps13c C A 9: 67,914,073 D1288E probably benign Het
Zfp458 T A 13: 67,257,236 M380L probably benign Het
Zfp638 A G 6: 83,929,455 N201D possibly damaging Het
Other mutations in Pwp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01892:Pwp2 APN 10 78179007 missense probably damaging 1.00
IGL02163:Pwp2 APN 10 78178285 missense possibly damaging 0.82
IGL02280:Pwp2 APN 10 78184100 missense probably damaging 0.99
IGL02558:Pwp2 APN 10 78179065 missense probably damaging 1.00
IGL02560:Pwp2 APN 10 78179065 missense probably damaging 1.00
IGL02583:Pwp2 APN 10 78181083 missense probably benign
IGL02612:Pwp2 APN 10 78182994 missense probably damaging 0.97
PIT4283001:Pwp2 UTSW 10 78185087 start codon destroyed probably null 1.00
PIT4449001:Pwp2 UTSW 10 78178470 missense probably benign 0.38
R0573:Pwp2 UTSW 10 78182686 missense probably benign 0.37
R1835:Pwp2 UTSW 10 78179091 missense probably damaging 1.00
R2097:Pwp2 UTSW 10 78177742 splice site probably benign
R2251:Pwp2 UTSW 10 78181088 missense probably benign 0.04
R2967:Pwp2 UTSW 10 78182698 missense possibly damaging 0.94
R4909:Pwp2 UTSW 10 78182494 missense possibly damaging 0.51
R4950:Pwp2 UTSW 10 78183006 missense probably benign 0.00
R4970:Pwp2 UTSW 10 78173693 missense possibly damaging 0.95
R5015:Pwp2 UTSW 10 78182693 missense probably benign 0.23
R5355:Pwp2 UTSW 10 78175544 missense possibly damaging 0.94
R5390:Pwp2 UTSW 10 78177771 missense possibly damaging 0.63
R5416:Pwp2 UTSW 10 78183001 missense probably damaging 1.00
R5841:Pwp2 UTSW 10 78172118 missense probably benign 0.00
R5928:Pwp2 UTSW 10 78182456 missense probably damaging 0.98
R6495:Pwp2 UTSW 10 78177127 missense probably damaging 1.00
R6771:Pwp2 UTSW 10 78182388 splice site probably null
R6848:Pwp2 UTSW 10 78184293 splice site probably null
R6897:Pwp2 UTSW 10 78172083 missense probably damaging 1.00
R7060:Pwp2 UTSW 10 78173250 splice site probably null
R7269:Pwp2 UTSW 10 78176336 missense probably benign 0.30
R7367:Pwp2 UTSW 10 78182480 missense probably damaging 1.00
R7394:Pwp2 UTSW 10 78182480 missense probably damaging 1.00
R7728:Pwp2 UTSW 10 78178561 missense probably benign 0.00
R7838:Pwp2 UTSW 10 78182944 critical splice donor site probably null
R7898:Pwp2 UTSW 10 78173406 missense probably damaging 1.00
R8072:Pwp2 UTSW 10 78172096 missense possibly damaging 0.82
R8447:Pwp2 UTSW 10 78172039 missense probably benign 0.10
R8750:Pwp2 UTSW 10 78177825 missense probably damaging 1.00
Z1177:Pwp2 UTSW 10 78171974 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCAAACTACAATGGGCTCATG -3'
(R):5'- ACCACTTCCACTTCAAGGGC -3'

Sequencing Primer
(F):5'- GGCTCATGGCGCACTTAAAAAC -3'
(R):5'- TCCACTTCAAGGGCTCCGTG -3'
Posted On2019-09-13