Mutagenetix > Incidental Mutation

Incidental Mutation 'R7368:Usp15'

571939

Institutional Source

Beutler Lab

Gene Symbol

Usp15

Ensembl Gene

ENSMUSG00000020124

Gene Name

ubiquitin specific peptidase 15

Synonyms

Gcap18, 4921514G19Rik, E430033I05Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7368 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

123105006-123196995 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 123196893 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 8 (D8G)

Ref Sequence

ENSEMBL: ENSMUSP00000151244 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020334] [ENSMUST00000220377]

AlphaFold

Q8R5H1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020334
AA Change: D8G

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000020334
Gene: ENSMUSG00000020124
AA Change: D8G

Domain	Start	End	E-Value	Type
DUSP	23	121	1.5e-46	SMART
Pfam:Ubiquitin_3	135	222	3.7e-38	PFAM
low complexity region	242	262	N/A	INTRINSIC
Pfam:UCH	288	930	6.8e-86	PFAM
Pfam:UCH_1	289	506	1.1e-5	PFAM
Pfam:USP7_C2	460	608	2e-7	PFAM
Pfam:UCH_1	756	912	1.3e-11	PFAM
low complexity region	959	976	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000220377
AA Change: D8G

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the large ubiquitin specific protease (Usp) family of proteins. These proteins are known to cleave ubiquitin, and contain a conserved cysteine residue (Cys box) and two conserved histidine residues (His box) that are thought to form part of the active site of the protease. This protein has been shown to cleave both the ubiquitin-proline and the ubiquitin-methionine bonds in vitro. This protein is thought to regulate many cellular processes through its deubiquitination activity, including the transforming growth factor beta (TGF-beta) pathway. Cardiac-specific overexpression of the human ortholog of this gene in mice causes enlargement of the heart that is more pronounced in the atrium than in the ventricle. This gene has two pseudogenes on chromosome 14. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms.[provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a knock-out allele or ENU induced allele exhibit resistance to pathological neuroinflammation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcd4	A	T	12: 84,612,865	F153I	possibly damaging	Het
Adcy1	G	A	11: 7,144,765	V564I	probably damaging	Het
Apol9b	T	C	15: 77,735,934	I310T	possibly damaging	Het
Arhgef28	C	A	13: 97,996,862	V366F	probably benign	Het
B020004C17Rik	C	T	14: 57,017,316	T199I	possibly damaging	Het
Carmil2	C	T	8: 105,690,835	T575I	possibly damaging	Het
Catsper1	A	T	19: 5,336,663	Q308L	unknown	Het
Cpa2	T	A	6: 30,551,990	S239T	probably damaging	Het
Ddit3	G	A	10: 127,295,907	G108D	probably damaging	Het
Dnah3	T	C	7: 120,029,016	I1473V	probably benign	Het
Dscam	A	G	16: 96,643,931	V1520A	probably benign	Het
Edc4	TAGTAGCAGCAGCAGTAGCAGCAGCAG	TAGTAGCAGCAGCAG	8: 105,888,405		probably benign	Het
Ednrb	T	A	14: 103,820,017	I370F	probably benign	Het
Ehd3	A	G	17: 73,827,462	E272G	possibly damaging	Het
Epha7	C	T	4: 28,871,937	S422L	probably benign	Het
Fam49b	A	T	15: 63,938,658		probably null	Het
Fkbp11	T	C	15: 98,724,426	K189E	unknown	Het
Frem1	T	A	4: 82,966,144	E1190D	probably benign	Het
Gabrg2	A	C	11: 41,976,563	Y76*	probably null	Het
Gm11437	T	A	11: 84,167,472		probably benign	Het
Gm8947	C	A	1: 151,193,096	Q227K	probably benign	Het
Gm9195	A	G	14: 72,480,056	F279S	probably damaging	Het
Gpbp1l1	T	C	4: 116,573,458	I42T	probably benign	Het
Hdac5	A	T	11: 102,197,381	V939E	probably null	Het
Hivep3	CGG	CG	4: 120,097,911	1141	probably null	Het
Kitl	A	T	10: 100,016,081	I21F	probably benign	Het
Krt1	T	C	15: 101,846,872	D484G	probably damaging	Het
Larp1	C	A	11: 58,048,078	P527T	probably damaging	Het
Lrp5	A	G	19: 3,620,085	V673A	possibly damaging	Het
Lrp6	G	T	6: 134,450,818	P1604T	probably damaging	Het
Mmp27	G	A	9: 7,577,317	V228M	probably damaging	Het
Ms4a6d	G	A	19: 11,590,073	Q155*	probably null	Het
Myo15	G	T	11: 60,490,915		probably null	Het
Myt1	A	G	2: 181,782,591	K26E	possibly damaging	Het
Nek1	T	A	8: 61,089,707	I777N	probably benign	Het
Nlrc5	C	T	8: 94,476,393	R374*	probably null	Het
Nol8	T	C	13: 49,661,219	S268P	probably benign	Het
Nynrin	T	A	14: 55,870,511	L1025Q	probably damaging	Het
Olfr1099	A	G	2: 86,959,258	S67P	probably damaging	Het
Osbpl3	A	T	6: 50,348,098	L140H	probably damaging	Het
Pcnt	T	C	10: 76,400,001	N1382S	probably benign	Het
Pef1	T	A	4: 130,127,385	L244*	probably null	Het
Phf11a	T	C	14: 59,280,725	E191G	probably benign	Het
Polr3a	A	T	14: 24,467,076	D702E	probably damaging	Het
Ptch1	C	T	13: 63,511,984	G1285D	probably benign	Het
Ptpn3	T	C	4: 57,221,993	D566G	probably damaging	Het
Pwp2	C	T	10: 78,182,480	G126R	probably damaging	Het
Scgb1b12	T	C	7: 32,334,567	I84T	probably damaging	Het
Sh2b1	A	T	7: 126,468,513	D618E	possibly damaging	Het
Slc35f5	T	A	1: 125,584,519	V352E	probably damaging	Het
Sppl2c	A	G	11: 104,187,604	E410G	probably damaging	Het
St6galnac2	T	C	11: 116,679,979	Y261C	probably damaging	Het
Stra6	G	A	9: 58,151,260	R468Q	probably benign	Het
Taf3	T	C	2: 9,916,377	H924R	unknown	Het
Tbx18	C	A	9: 87,730,697	V50L	probably benign	Het
Tgoln1	G	C	6: 72,616,278	T73R	probably benign	Het
Unc45b	C	T	11: 82,942,495	T845I	probably benign	Het
Vmn2r91	A	G	17: 18,136,278	I736V	possibly damaging	Het
Vps13c	C	A	9: 67,914,073	D1288E	probably benign	Het
Zfp458	T	A	13: 67,257,236	M380L	probably benign	Het
Zfp638	A	G	6: 83,929,455	N201D	possibly damaging	Het

Other mutations in Usp15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Usp15	APN	10	123113596	missense	probably benign	0.00
IGL02148:Usp15	APN	10	123127837	missense	probably damaging	1.00
IGL02737:Usp15	APN	10	123131032	missense	probably damaging	1.00
IGL03054:Usp15	APN	10	123125931	splice site	probably benign
IGL03163:Usp15	APN	10	123171144	missense	probably damaging	0.96
R1755:Usp15	UTSW	10	123133044	missense	probably damaging	0.98
R1981:Usp15	UTSW	10	123125041	splice site	probably benign
R2049:Usp15	UTSW	10	123119137	missense	probably damaging	1.00
R3037:Usp15	UTSW	10	123163617	missense	probably damaging	1.00
R3698:Usp15	UTSW	10	123181738	missense	probably damaging	1.00
R3828:Usp15	UTSW	10	123196870	missense	possibly damaging	0.95
R3845:Usp15	UTSW	10	123119135	missense	probably damaging	1.00
R4838:Usp15	UTSW	10	123127757	missense	probably damaging	0.99
R4954:Usp15	UTSW	10	123131398	missense	probably damaging	1.00
R5204:Usp15	UTSW	10	123113640	missense	probably benign	0.06
R5274:Usp15	UTSW	10	123168351	missense	probably damaging	1.00
R5387:Usp15	UTSW	10	123131286	missense	probably damaging	0.96
R5474:Usp15	UTSW	10	123128045	missense	probably damaging	1.00
R5501:Usp15	UTSW	10	123175899	missense	probably damaging	0.99
R5665:Usp15	UTSW	10	123130987	nonsense	probably null
R5846:Usp15	UTSW	10	123181742	missense	probably damaging	1.00
R5850:Usp15	UTSW	10	123124512	critical splice donor site	probably null
R6163:Usp15	UTSW	10	123168305	missense	probably damaging	1.00
R6735:Usp15	UTSW	10	123168367	missense	possibly damaging	0.86
R6828:Usp15	UTSW	10	123127989	missense	probably damaging	1.00
R7170:Usp15	UTSW	10	123171195	missense	probably damaging	1.00
R7197:Usp15	UTSW	10	123131005	missense	possibly damaging	0.92
R7351:Usp15	UTSW	10	123132999	missense	probably damaging	1.00
R7447:Usp15	UTSW	10	123175881	missense	probably damaging	1.00
R8099:Usp15	UTSW	10	123146921	missense	possibly damaging	0.87
R8169:Usp15	UTSW	10	123125893	missense
R8316:Usp15	UTSW	10	123123943	missense
R8795:Usp15	UTSW	10	123153048	missense	probably benign	0.00
R9005:Usp15	UTSW	10	123146798	missense	possibly damaging	0.89
R9023:Usp15	UTSW	10	123125593	missense	possibly damaging	0.85
R9156:Usp15	UTSW	10	123113648	missense	probably benign	0.13
R9198:Usp15	UTSW	10	123168238	missense	probably damaging	1.00
R9278:Usp15	UTSW	10	123171207	missense	probably damaging	0.96
R9592:Usp15	UTSW	10	123163617	missense	probably damaging	1.00
Z1176:Usp15	UTSW	10	123196961	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- CCCAAAATCTGCTGCCTGAG -3'
(R):5'- ACCGTGCAAACTCAGAGGTC -3'

Sequencing Primer
(F):5'- TGTCCGCACCTGTCACCAG -3'
(R):5'- CTCAGAGGTCTGGGGCG -3'

Posted On

2019-09-13