Incidental Mutation 'R7368:Usp15'
ID 571939
Institutional Source Beutler Lab
Gene Symbol Usp15
Ensembl Gene ENSMUSG00000020124
Gene Name ubiquitin specific peptidase 15
Synonyms Gcap18, 4921514G19Rik, E430033I05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7368 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 123105006-123196995 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 123196893 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 8 (D8G)
Ref Sequence ENSEMBL: ENSMUSP00000151244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020334] [ENSMUST00000220377]
AlphaFold Q8R5H1
Predicted Effect possibly damaging
Transcript: ENSMUST00000020334
AA Change: D8G

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020334
Gene: ENSMUSG00000020124
AA Change: D8G

DomainStartEndE-ValueType
DUSP 23 121 1.5e-46 SMART
Pfam:Ubiquitin_3 135 222 3.7e-38 PFAM
low complexity region 242 262 N/A INTRINSIC
Pfam:UCH 288 930 6.8e-86 PFAM
Pfam:UCH_1 289 506 1.1e-5 PFAM
Pfam:USP7_C2 460 608 2e-7 PFAM
Pfam:UCH_1 756 912 1.3e-11 PFAM
low complexity region 959 976 N/A INTRINSIC
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000220377
AA Change: D8G

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the large ubiquitin specific protease (Usp) family of proteins. These proteins are known to cleave ubiquitin, and contain a conserved cysteine residue (Cys box) and two conserved histidine residues (His box) that are thought to form part of the active site of the protease. This protein has been shown to cleave both the ubiquitin-proline and the ubiquitin-methionine bonds in vitro. This protein is thought to regulate many cellular processes through its deubiquitination activity, including the transforming growth factor beta (TGF-beta) pathway. Cardiac-specific overexpression of the human ortholog of this gene in mice causes enlargement of the heart that is more pronounced in the atrium than in the ventricle. This gene has two pseudogenes on chromosome 14. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms.[provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a knock-out allele or ENU induced allele exhibit resistance to pathological neuroinflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 A T 12: 84,612,865 F153I possibly damaging Het
Adcy1 G A 11: 7,144,765 V564I probably damaging Het
Apol9b T C 15: 77,735,934 I310T possibly damaging Het
Arhgef28 C A 13: 97,996,862 V366F probably benign Het
B020004C17Rik C T 14: 57,017,316 T199I possibly damaging Het
Carmil2 C T 8: 105,690,835 T575I possibly damaging Het
Catsper1 A T 19: 5,336,663 Q308L unknown Het
Cpa2 T A 6: 30,551,990 S239T probably damaging Het
Ddit3 G A 10: 127,295,907 G108D probably damaging Het
Dnah3 T C 7: 120,029,016 I1473V probably benign Het
Dscam A G 16: 96,643,931 V1520A probably benign Het
Edc4 TAGTAGCAGCAGCAGTAGCAGCAGCAG TAGTAGCAGCAGCAG 8: 105,888,405 probably benign Het
Ednrb T A 14: 103,820,017 I370F probably benign Het
Ehd3 A G 17: 73,827,462 E272G possibly damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam49b A T 15: 63,938,658 probably null Het
Fkbp11 T C 15: 98,724,426 K189E unknown Het
Frem1 T A 4: 82,966,144 E1190D probably benign Het
Gabrg2 A C 11: 41,976,563 Y76* probably null Het
Gm11437 T A 11: 84,167,472 probably benign Het
Gm8947 C A 1: 151,193,096 Q227K probably benign Het
Gm9195 A G 14: 72,480,056 F279S probably damaging Het
Gpbp1l1 T C 4: 116,573,458 I42T probably benign Het
Hdac5 A T 11: 102,197,381 V939E probably null Het
Hivep3 CGG CG 4: 120,097,911 1141 probably null Het
Kitl A T 10: 100,016,081 I21F probably benign Het
Krt1 T C 15: 101,846,872 D484G probably damaging Het
Larp1 C A 11: 58,048,078 P527T probably damaging Het
Lrp5 A G 19: 3,620,085 V673A possibly damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Mmp27 G A 9: 7,577,317 V228M probably damaging Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo15 G T 11: 60,490,915 probably null Het
Myt1 A G 2: 181,782,591 K26E possibly damaging Het
Nek1 T A 8: 61,089,707 I777N probably benign Het
Nlrc5 C T 8: 94,476,393 R374* probably null Het
Nol8 T C 13: 49,661,219 S268P probably benign Het
Nynrin T A 14: 55,870,511 L1025Q probably damaging Het
Olfr1099 A G 2: 86,959,258 S67P probably damaging Het
Osbpl3 A T 6: 50,348,098 L140H probably damaging Het
Pcnt T C 10: 76,400,001 N1382S probably benign Het
Pef1 T A 4: 130,127,385 L244* probably null Het
Phf11a T C 14: 59,280,725 E191G probably benign Het
Polr3a A T 14: 24,467,076 D702E probably damaging Het
Ptch1 C T 13: 63,511,984 G1285D probably benign Het
Ptpn3 T C 4: 57,221,993 D566G probably damaging Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
Scgb1b12 T C 7: 32,334,567 I84T probably damaging Het
Sh2b1 A T 7: 126,468,513 D618E possibly damaging Het
Slc35f5 T A 1: 125,584,519 V352E probably damaging Het
Sppl2c A G 11: 104,187,604 E410G probably damaging Het
St6galnac2 T C 11: 116,679,979 Y261C probably damaging Het
Stra6 G A 9: 58,151,260 R468Q probably benign Het
Taf3 T C 2: 9,916,377 H924R unknown Het
Tbx18 C A 9: 87,730,697 V50L probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Unc45b C T 11: 82,942,495 T845I probably benign Het
Vmn2r91 A G 17: 18,136,278 I736V possibly damaging Het
Vps13c C A 9: 67,914,073 D1288E probably benign Het
Zfp458 T A 13: 67,257,236 M380L probably benign Het
Zfp638 A G 6: 83,929,455 N201D possibly damaging Het
Other mutations in Usp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Usp15 APN 10 123113596 missense probably benign 0.00
IGL02148:Usp15 APN 10 123127837 missense probably damaging 1.00
IGL02737:Usp15 APN 10 123131032 missense probably damaging 1.00
IGL03054:Usp15 APN 10 123125931 splice site probably benign
IGL03163:Usp15 APN 10 123171144 missense probably damaging 0.96
R1755:Usp15 UTSW 10 123133044 missense probably damaging 0.98
R1981:Usp15 UTSW 10 123125041 splice site probably benign
R2049:Usp15 UTSW 10 123119137 missense probably damaging 1.00
R3037:Usp15 UTSW 10 123163617 missense probably damaging 1.00
R3698:Usp15 UTSW 10 123181738 missense probably damaging 1.00
R3828:Usp15 UTSW 10 123196870 missense possibly damaging 0.95
R3845:Usp15 UTSW 10 123119135 missense probably damaging 1.00
R4838:Usp15 UTSW 10 123127757 missense probably damaging 0.99
R4954:Usp15 UTSW 10 123131398 missense probably damaging 1.00
R5204:Usp15 UTSW 10 123113640 missense probably benign 0.06
R5274:Usp15 UTSW 10 123168351 missense probably damaging 1.00
R5387:Usp15 UTSW 10 123131286 missense probably damaging 0.96
R5474:Usp15 UTSW 10 123128045 missense probably damaging 1.00
R5501:Usp15 UTSW 10 123175899 missense probably damaging 0.99
R5665:Usp15 UTSW 10 123130987 nonsense probably null
R5846:Usp15 UTSW 10 123181742 missense probably damaging 1.00
R5850:Usp15 UTSW 10 123124512 critical splice donor site probably null
R6163:Usp15 UTSW 10 123168305 missense probably damaging 1.00
R6735:Usp15 UTSW 10 123168367 missense possibly damaging 0.86
R6828:Usp15 UTSW 10 123127989 missense probably damaging 1.00
R7170:Usp15 UTSW 10 123171195 missense probably damaging 1.00
R7197:Usp15 UTSW 10 123131005 missense possibly damaging 0.92
R7351:Usp15 UTSW 10 123132999 missense probably damaging 1.00
R7447:Usp15 UTSW 10 123175881 missense probably damaging 1.00
R8099:Usp15 UTSW 10 123146921 missense possibly damaging 0.87
R8169:Usp15 UTSW 10 123125893 missense
R8316:Usp15 UTSW 10 123123943 missense
R8795:Usp15 UTSW 10 123153048 missense probably benign 0.00
R9005:Usp15 UTSW 10 123146798 missense possibly damaging 0.89
R9023:Usp15 UTSW 10 123125593 missense possibly damaging 0.85
R9156:Usp15 UTSW 10 123113648 missense probably benign 0.13
R9198:Usp15 UTSW 10 123168238 missense probably damaging 1.00
R9278:Usp15 UTSW 10 123171207 missense probably damaging 0.96
R9592:Usp15 UTSW 10 123163617 missense probably damaging 1.00
Z1176:Usp15 UTSW 10 123196961 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCCAAAATCTGCTGCCTGAG -3'
(R):5'- ACCGTGCAAACTCAGAGGTC -3'

Sequencing Primer
(F):5'- TGTCCGCACCTGTCACCAG -3'
(R):5'- CTCAGAGGTCTGGGGCG -3'
Posted On 2019-09-13