Incidental Mutation 'R7368:Unc45b'
ID571944
Institutional Source Beutler Lab
Gene Symbol Unc45b
Ensembl Gene ENSMUSG00000018845
Gene Nameunc-45 myosin chaperone B
SynonymsCmya4, D230041A13Rik, UNC45
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7368 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location82910550-82943403 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 82942495 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 845 (T845I)
Ref Sequence ENSEMBL: ENSMUSP00000018989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018989] [ENSMUST00000108160] [ENSMUST00000164945]
Predicted Effect probably benign
Transcript: ENSMUST00000018989
AA Change: T845I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000018989
Gene: ENSMUSG00000018845
AA Change: T845I

DomainStartEndE-ValueType
TPR 6 39 1.02e1 SMART
TPR 43 76 7.47e0 SMART
TPR 77 110 2.52e-1 SMART
Blast:ARM 167 208 3e-16 BLAST
Blast:ARM 210 250 1e-10 BLAST
Pfam:UNC45-central 298 489 1.7e-41 PFAM
Blast:ARM 541 582 7e-7 BLAST
Blast:ARM 661 701 2e-14 BLAST
Blast:ARM 704 746 5e-11 BLAST
Blast:ARM 747 788 1e-20 BLAST
Blast:ARM 789 820 1e-11 BLAST
low complexity region 821 832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108160
AA Change: T847I

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000103795
Gene: ENSMUSG00000018845
AA Change: T847I

DomainStartEndE-ValueType
TPR 6 39 1.02e1 SMART
TPR 43 76 7.47e0 SMART
TPR 77 110 2.52e-1 SMART
Blast:ARM 167 208 3e-16 BLAST
Blast:ARM 210 250 1e-10 BLAST
Pfam:UNC45-central 271 489 2.2e-52 PFAM
Blast:ARM 663 703 2e-14 BLAST
Blast:ARM 706 748 5e-11 BLAST
Blast:ARM 749 790 1e-20 BLAST
Blast:ARM 791 822 1e-11 BLAST
low complexity region 823 834 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164945
AA Change: T847I

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000129405
Gene: ENSMUSG00000018845
AA Change: T847I

DomainStartEndE-ValueType
TPR 6 39 1.02e1 SMART
TPR 43 76 7.47e0 SMART
TPR 77 110 2.52e-1 SMART
Blast:ARM 167 208 3e-16 BLAST
Blast:ARM 210 250 1e-10 BLAST
Pfam:UNC45-central 298 489 1.7e-41 PFAM
Blast:ARM 663 703 2e-14 BLAST
Blast:ARM 706 748 5e-11 BLAST
Blast:ARM 749 790 1e-20 BLAST
Blast:ARM 791 822 1e-11 BLAST
low complexity region 823 834 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a co-chaperone required for folding and accumulation of type II myosins. The protein consists of three tetratricopeptide repeat motifs at the N-terminus that form a complex with heat shock protein 90, a central region of unknown function that is conserved in all Unc-45 proteins, and a C-terminal Unc-45/Cro1/She4 domain. The protein is expressed at high levels in striated muscle, where its muscle myosin chaperone activity is dependent on heat shock protein 90 acting as a co-chaperone. A missense mutation in this gene has been associated with cataract development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E9 without placental abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 A T 12: 84,612,865 F153I possibly damaging Het
Adcy1 G A 11: 7,144,765 V564I probably damaging Het
Apol9b T C 15: 77,735,934 I310T possibly damaging Het
Arhgef28 C A 13: 97,996,862 V366F probably benign Het
B020004C17Rik C T 14: 57,017,316 T199I possibly damaging Het
Carmil2 C T 8: 105,690,835 T575I possibly damaging Het
Catsper1 A T 19: 5,336,663 Q308L unknown Het
Cpa2 T A 6: 30,551,990 S239T probably damaging Het
Ddit3 G A 10: 127,295,907 G108D probably damaging Het
Dnah3 T C 7: 120,029,016 I1473V probably benign Het
Dscam A G 16: 96,643,931 V1520A probably benign Het
Edc4 TAGTAGCAGCAGCAGTAGCAGCAGCAG TAGTAGCAGCAGCAG 8: 105,888,405 probably benign Het
Ednrb T A 14: 103,820,017 I370F probably benign Het
Ehd3 A G 17: 73,827,462 E272G possibly damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam49b A T 15: 63,938,658 probably null Het
Fkbp11 T C 15: 98,724,426 K189E unknown Het
Frem1 T A 4: 82,966,144 E1190D probably benign Het
Gabrg2 A C 11: 41,976,563 Y76* probably null Het
Gm11437 T A 11: 84,167,472 probably benign Het
Gm8947 C A 1: 151,193,096 Q227K probably benign Het
Gm9195 A G 14: 72,480,056 F279S probably damaging Het
Gpbp1l1 T C 4: 116,573,458 I42T probably benign Het
Hdac5 A T 11: 102,197,381 V939E probably null Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kitl A T 10: 100,016,081 I21F probably benign Het
Krt1 T C 15: 101,846,872 D484G probably damaging Het
Larp1 C A 11: 58,048,078 P527T probably damaging Het
Lrp5 A G 19: 3,620,085 V673A possibly damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Mmp27 G A 9: 7,577,317 V228M probably damaging Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo15 G T 11: 60,490,915 probably null Het
Myt1 A G 2: 181,782,591 K26E possibly damaging Het
Nek1 T A 8: 61,089,707 I777N probably benign Het
Nlrc5 C T 8: 94,476,393 R374* probably null Het
Nol8 T C 13: 49,661,219 S268P probably benign Het
Nynrin T A 14: 55,870,511 L1025Q probably damaging Het
Olfr1099 A G 2: 86,959,258 S67P probably damaging Het
Osbpl3 A T 6: 50,348,098 L140H probably damaging Het
Pcnt T C 10: 76,400,001 N1382S probably benign Het
Pef1 T A 4: 130,127,385 L244* probably null Het
Phf11a T C 14: 59,280,725 E191G probably benign Het
Polr3a A T 14: 24,467,076 D702E probably damaging Het
Ptch1 C T 13: 63,511,984 G1285D probably benign Het
Ptpn3 T C 4: 57,221,993 D566G probably damaging Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
Scgb1b12 T C 7: 32,334,567 I84T probably damaging Het
Sh2b1 A T 7: 126,468,513 D618E possibly damaging Het
Slc35f5 T A 1: 125,584,519 V352E probably damaging Het
Sppl2c A G 11: 104,187,604 E410G probably damaging Het
St6galnac2 T C 11: 116,679,979 Y261C probably damaging Het
Stra6 G A 9: 58,151,260 R468Q probably benign Het
Taf3 T C 2: 9,916,377 H924R unknown Het
Tbx18 C A 9: 87,730,697 V50L probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Usp15 T C 10: 123,196,893 D8G possibly damaging Het
Vmn2r91 A G 17: 18,136,278 I736V possibly damaging Het
Vps13c C A 9: 67,914,073 D1288E probably benign Het
Zfp458 T A 13: 67,257,236 M380L probably benign Het
Zfp638 A G 6: 83,929,455 N201D possibly damaging Het
Other mutations in Unc45b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:Unc45b APN 11 82912393 critical splice acceptor site probably null
IGL01983:Unc45b APN 11 82936861 missense probably benign
IGL02083:Unc45b APN 11 82922919 missense probably damaging 0.96
IGL02159:Unc45b APN 11 82940181 splice site probably benign
IGL02160:Unc45b APN 11 82940181 splice site probably benign
IGL02165:Unc45b APN 11 82940181 splice site probably benign
IGL02166:Unc45b APN 11 82940181 splice site probably benign
IGL02986:Unc45b APN 11 82917179 missense probably damaging 0.98
fife UTSW 11 82936852 missense probably benign 0.00
R0195:Unc45b UTSW 11 82937828 missense probably damaging 1.00
R0197:Unc45b UTSW 11 82940205 missense possibly damaging 0.78
R0218:Unc45b UTSW 11 82911860 splice site probably benign
R0436:Unc45b UTSW 11 82929567 splice site probably benign
R0569:Unc45b UTSW 11 82936812 splice site probably benign
R0701:Unc45b UTSW 11 82940205 missense possibly damaging 0.78
R0883:Unc45b UTSW 11 82940205 missense possibly damaging 0.78
R1146:Unc45b UTSW 11 82922907 missense probably damaging 0.99
R1146:Unc45b UTSW 11 82922907 missense probably damaging 0.99
R1378:Unc45b UTSW 11 82936852 missense probably benign 0.00
R1446:Unc45b UTSW 11 82928670 missense probably damaging 1.00
R1532:Unc45b UTSW 11 82936874 missense probably benign 0.12
R1559:Unc45b UTSW 11 82917846 missense possibly damaging 0.66
R1582:Unc45b UTSW 11 82925945 missense probably benign 0.30
R1628:Unc45b UTSW 11 82929380 splice site probably null
R1666:Unc45b UTSW 11 82917739 missense probably benign 0.31
R1677:Unc45b UTSW 11 82911705 splice site probably null
R1759:Unc45b UTSW 11 82929499 missense probably benign 0.33
R1909:Unc45b UTSW 11 82926087 missense probably damaging 1.00
R2067:Unc45b UTSW 11 82911689 missense probably benign 0.01
R2111:Unc45b UTSW 11 82911689 missense probably benign 0.01
R2145:Unc45b UTSW 11 82917754 missense probably benign 0.30
R2258:Unc45b UTSW 11 82917799 missense probably benign 0.01
R2259:Unc45b UTSW 11 82917799 missense probably benign 0.01
R2497:Unc45b UTSW 11 82936443 missense probably damaging 1.00
R2507:Unc45b UTSW 11 82940137 splice site probably null
R4352:Unc45b UTSW 11 82913209 missense probably damaging 0.99
R4569:Unc45b UTSW 11 82936489 critical splice donor site probably null
R4624:Unc45b UTSW 11 82926009 missense probably benign 0.30
R5236:Unc45b UTSW 11 82915062 missense possibly damaging 0.53
R5512:Unc45b UTSW 11 82915072 missense possibly damaging 0.47
R5688:Unc45b UTSW 11 82922817 missense possibly damaging 0.88
R6029:Unc45b UTSW 11 82913327 missense probably damaging 1.00
R6616:Unc45b UTSW 11 82911819 missense probably damaging 1.00
R6857:Unc45b UTSW 11 82913212 missense probably benign 0.00
R6876:Unc45b UTSW 11 82922912 missense probably benign 0.00
R7197:Unc45b UTSW 11 82940187 critical splice acceptor site probably null
R7531:Unc45b UTSW 11 82929012 missense probably damaging 1.00
R7743:Unc45b UTSW 11 82922900 missense probably damaging 1.00
R8198:Unc45b UTSW 11 82925988 frame shift probably null
R8214:Unc45b UTSW 11 82933888 missense possibly damaging 0.50
R8235:Unc45b UTSW 11 82919855 missense probably benign 0.01
R8916:Unc45b UTSW 11 82913212 missense probably benign 0.00
T0970:Unc45b UTSW 11 82922888 missense probably benign 0.00
Z1176:Unc45b UTSW 11 82928654 critical splice acceptor site probably null
Z1176:Unc45b UTSW 11 82942715 missense probably damaging 1.00
Z1177:Unc45b UTSW 11 82942553 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCGTACATTCATGCACAGGC -3'
(R):5'- ACTTGATAAGACACTCCCGGG -3'

Sequencing Primer
(F):5'- CACAGGCAGGATGAATGAATGAATC -3'
(R):5'- ATAAGACACTCCCGGGCTGTC -3'
Posted On2019-09-13