Incidental Mutation 'R7369:Klf7'
ID571970
Institutional Source Beutler Lab
Gene Symbol Klf7
Ensembl Gene ENSMUSG00000025959
Gene NameKruppel-like factor 7 (ubiquitous)
Synonyms9830124P08Rik
Accession Numbers

Genbank: NM_033563; MGI: 1935151

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7369 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location64029447-64122282 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 64121141 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055001] [ENSMUST00000114086] [ENSMUST00000135075]
Predicted Effect probably null
Transcript: ENSMUST00000055001
SMART Domains Protein: ENSMUSP00000054674
Gene: ENSMUSG00000025959

DomainStartEndE-ValueType
low complexity region 134 145 N/A INTRINSIC
low complexity region 162 194 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
ZnF_C2H2 218 242 3.83e-2 SMART
ZnF_C2H2 248 272 4.94e-5 SMART
ZnF_C2H2 278 300 6.78e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114086
SMART Domains Protein: ENSMUSP00000109720
Gene: ENSMUSG00000025959

DomainStartEndE-ValueType
low complexity region 134 145 N/A INTRINSIC
low complexity region 162 194 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
ZnF_C2H2 218 242 3.83e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000135075
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Kruppel-like transcriptional regulator family. Members in this family regulate cell proliferation, differentiation and survival and contain three C2H2 zinc fingers at the C-terminus that mediate binding to GC-rich sites. This protein may contribute to the progression of type 2 diabetes by inhibiting insulin expression and secretion in pancreatic beta-cells and by deregulating adipocytokine secretion in adipocytes. A pseudogene of this gene is located on the long arm of chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygous null mice die within 3 days of life, showing lack of gastic milk, hypopnea, cyanosis, olfactory bulb hypoplasia, no response to tail clamping, impaired axon projection in the olfactory and visual systems, cerebral cortex and hippocampus, and reduced dendritic branching in the hippocampus. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T A 6: 129,331,533 Q11L possibly damaging Het
A930017K11Rik G A 17: 25,947,960 S201L probably damaging Het
Ahr A T 12: 35,504,660 W487R possibly damaging Het
Apaf1 A G 10: 91,001,036 S1060P probably damaging Het
Atf7 G T 15: 102,553,809 P126H probably damaging Het
B3gnt5 C A 16: 19,769,660 Q210K probably benign Het
Begain T C 12: 109,033,927 Y306C possibly damaging Het
Car5a T C 8: 121,923,834 K157R probably benign Het
Car5b A C X: 164,014,840 S35R probably benign Het
Cdh6 A G 15: 13,042,638 V478A probably damaging Het
Cdyl A G 13: 35,816,009 E91G probably damaging Het
Cep135 A C 5: 76,593,253 K59Q possibly damaging Het
Cnot3 T A 7: 3,653,331 D205E possibly damaging Het
Dgkd G A 1: 87,921,622 G379R probably damaging Het
Dppa1 T A 11: 46,616,117 probably null Het
Dsp G T 13: 38,197,525 V2749F possibly damaging Het
E2f4 A G 8: 105,300,334 K177E probably benign Het
Efcab5 G A 11: 77,117,835 P819L possibly damaging Het
Ercc5 T A 1: 44,180,860 S1097R probably benign Het
Erp44 T C 4: 48,218,183 N162S probably benign Het
Evl A G 12: 108,686,565 Y423C unknown Het
Fam78a T A 2: 32,069,687 N137I probably damaging Het
Fcrla T G 1: 170,922,317 D57A probably benign Het
Fcrls T C 3: 87,256,701 N374D possibly damaging Het
Gm7145 A T 1: 117,986,108 H240L probably benign Het
Kdm5a T A 6: 120,432,004 N1549K possibly damaging Het
Kirrel C T 3: 87,141,084 R9H probably benign Het
Lce1d G A 3: 92,686,083 Q8* probably null Het
Lcn4 T C 2: 26,667,894 H180R probably benign Het
Lmntd1 T A 6: 145,413,575 Y283F probably damaging Het
Lrp1b C T 2: 41,282,039 R1646K Het
Map3k21 C A 8: 125,911,116 A147E possibly damaging Het
Mapk8ip2 T C 15: 89,454,251 S11P probably benign Het
Mdn1 T A 4: 32,773,375 F5518L probably damaging Het
Mfsd7a A G 5: 108,445,528 V148A probably benign Het
Msh3 T A 13: 92,299,262 T510S probably benign Het
Myh1 A T 11: 67,220,698 Q1654H probably damaging Het
Ncbp3 T C 11: 73,077,921 V506A probably benign Het
Nfkbiz A G 16: 55,821,846 S70P probably damaging Het
Nmi T C 2: 51,950,084 D215G possibly damaging Het
Nphp3 T C 9: 104,018,250 S496P probably damaging Het
Nrp1 T A 8: 128,431,915 C228S probably damaging Het
Olfr787 A T 10: 129,463,521 M282L probably benign Het
Pcdh9 C A 14: 93,886,367 R789L possibly damaging Het
Pigr A T 1: 130,841,766 T105S probably benign Het
Polr2a A C 11: 69,745,977 S383A probably benign Het
Psd3 T A 8: 67,904,166 H634L possibly damaging Het
Ptgr2 T G 12: 84,292,306 probably benign Het
Ptk6 A G 2: 181,198,461 Y251H possibly damaging Het
Rnf213 A G 11: 119,430,468 T1251A Het
Rtkn2 A G 10: 68,041,429 K443E probably damaging Het
Rundc3a T A 11: 102,399,895 L268Q probably damaging Het
Serpinb5 A G 1: 106,875,149 E138G probably benign Het
Shroom1 A T 11: 53,465,248 D375V probably benign Het
Siglecf A G 7: 43,351,817 T70A probably damaging Het
Slc20a2 A T 8: 22,561,400 E483V probably benign Het
Sort1 G A 3: 108,351,680 G676D probably damaging Het
Spef2 T C 15: 9,584,207 S1581G probably benign Het
Stx6 C T 1: 155,197,384 R214* probably null Het
Stxbp5l A G 16: 37,134,341 I950T probably benign Het
Tdrd7 T A 4: 46,013,239 C660S possibly damaging Het
Tgm4 T A 9: 123,056,684 probably null Het
Thap8 C T 7: 30,289,952 L196F unknown Het
Tmem67 T C 4: 12,053,535 Y671C probably damaging Het
Ttc6 A T 12: 57,672,931 probably null Het
Uba2 A G 7: 34,150,814 S405P possibly damaging Het
Usp34 T C 11: 23,432,361 I2043T Het
Vmn1r12 T A 6: 57,159,698 I260N possibly damaging Het
Vmn1r172 C T 7: 23,660,605 T305I unknown Het
Vmn2r24 T C 6: 123,815,679 V655A probably damaging Het
Wdr33 T C 18: 31,886,666 S464P probably benign Het
Zcchc6 A G 13: 59,782,053 I1458T possibly damaging Het
Zfp260 T A 7: 30,105,325 C217S probably damaging Het
Zfp760 A G 17: 21,723,233 E463G probably benign Het
Zhx1 A G 15: 58,053,300 Y517H probably damaging Het
Other mutations in Klf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Klf7 APN 1 64042317 missense possibly damaging 0.65
IGL01684:Klf7 APN 1 64120892 splice site probably benign
IGL01844:Klf7 APN 1 64078774 missense probably benign 0.02
IGL03181:Klf7 APN 1 64035726 missense possibly damaging 0.88
Esurientes UTSW 1 64079213 missense possibly damaging 0.78
C9142:Klf7 UTSW 1 64079157 missense possibly damaging 0.47
R1736:Klf7 UTSW 1 64079213 missense possibly damaging 0.78
R1737:Klf7 UTSW 1 64079213 missense possibly damaging 0.78
R1744:Klf7 UTSW 1 64079213 missense possibly damaging 0.78
R2048:Klf7 UTSW 1 64078754 missense possibly damaging 0.65
R2891:Klf7 UTSW 1 64042362 missense probably damaging 1.00
R5055:Klf7 UTSW 1 64079280 missense probably benign 0.08
R5613:Klf7 UTSW 1 64042396 missense probably damaging 0.98
R5782:Klf7 UTSW 1 64042411 missense possibly damaging 0.81
R7470:Klf7 UTSW 1 64042313 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGACAAGTTGTAGCTCCTGG -3'
(R):5'- TGGAGTGATTAGAGCCCTGG -3'

Sequencing Primer
(F):5'- GACAAGTTGTAGCTCCTGGAATATAC -3'
(R):5'- GGAATTGTTACTCCCGTGAAGTCC -3'
Posted On2019-09-13