Incidental Mutation 'R7369:Tmem67'
ID571986
Institutional Source Beutler Lab
Gene Symbol Tmem67
Ensembl Gene ENSMUSG00000049488
Gene Nametransmembrane protein 67
Synonymsb2b1291.1Clo, 5330408M12Rik, b2b1163.1Clo
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7369 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location12039355-12090020 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12053535 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 671 (Y671C)
Ref Sequence ENSEMBL: ENSMUSP00000052644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050686] [ENSMUST00000108293]
Predicted Effect probably damaging
Transcript: ENSMUST00000050686
AA Change: Y671C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052644
Gene: ENSMUSG00000049488
AA Change: Y671C

DomainStartEndE-ValueType
low complexity region 17 23 N/A INTRINSIC
Pfam:Meckelin 166 995 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108293
AA Change: Y737C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103928
Gene: ENSMUSG00000049488
AA Change: Y737C

DomainStartEndE-ValueType
low complexity region 83 89 N/A INTRINSIC
Pfam:Meckelin 236 1061 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131145
SMART Domains Protein: ENSMUSP00000115154
Gene: ENSMUSG00000049488

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the primary cilium and to the plasma membrane. The gene functions in centriole migration to the apical membrane and formation of the primary cilium. Multiple transcript variants encoding different isoforms have been found for this gene. Defects in this gene are a cause of Meckel syndrome type 3 (MKS3) and Joubert syndrome type 6 (JBTS6). [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit neonatal/postanal lethality, kidney cysts, and Meckel-Gruber or Joubert syndrome-like phenotypes depending on the filial generation of the backcross to C57BL/6J. Mice homozygous for an ENU-induced allele exhibit cardiovascular defects and cystic kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T A 6: 129,331,533 Q11L possibly damaging Het
A930017K11Rik G A 17: 25,947,960 S201L probably damaging Het
Ahr A T 12: 35,504,660 W487R possibly damaging Het
Apaf1 A G 10: 91,001,036 S1060P probably damaging Het
Atf7 G T 15: 102,553,809 P126H probably damaging Het
B3gnt5 C A 16: 19,769,660 Q210K probably benign Het
Begain T C 12: 109,033,927 Y306C possibly damaging Het
Car5a T C 8: 121,923,834 K157R probably benign Het
Car5b A C X: 164,014,840 S35R probably benign Het
Cdh6 A G 15: 13,042,638 V478A probably damaging Het
Cdyl A G 13: 35,816,009 E91G probably damaging Het
Cep135 A C 5: 76,593,253 K59Q possibly damaging Het
Cnot3 T A 7: 3,653,331 D205E possibly damaging Het
Dgkd G A 1: 87,921,622 G379R probably damaging Het
Dppa1 T A 11: 46,616,117 probably null Het
Dsp G T 13: 38,197,525 V2749F possibly damaging Het
E2f4 A G 8: 105,300,334 K177E probably benign Het
Efcab5 G A 11: 77,117,835 P819L possibly damaging Het
Ercc5 T A 1: 44,180,860 S1097R probably benign Het
Erp44 T C 4: 48,218,183 N162S probably benign Het
Evl A G 12: 108,686,565 Y423C unknown Het
Fam78a T A 2: 32,069,687 N137I probably damaging Het
Fcrla T G 1: 170,922,317 D57A probably benign Het
Fcrls T C 3: 87,256,701 N374D possibly damaging Het
Gm7145 A T 1: 117,986,108 H240L probably benign Het
Kdm5a T A 6: 120,432,004 N1549K possibly damaging Het
Kirrel C T 3: 87,141,084 R9H probably benign Het
Klf7 T C 1: 64,121,141 probably null Het
Lce1d G A 3: 92,686,083 Q8* probably null Het
Lcn4 T C 2: 26,667,894 H180R probably benign Het
Lmntd1 T A 6: 145,413,575 Y283F probably damaging Het
Lrp1b C T 2: 41,282,039 R1646K Het
Map3k21 C A 8: 125,911,116 A147E possibly damaging Het
Mapk8ip2 T C 15: 89,454,251 S11P probably benign Het
Mdn1 T A 4: 32,773,375 F5518L probably damaging Het
Mfsd7a A G 5: 108,445,528 V148A probably benign Het
Msh3 T A 13: 92,299,262 T510S probably benign Het
Myh1 A T 11: 67,220,698 Q1654H probably damaging Het
Ncbp3 T C 11: 73,077,921 V506A probably benign Het
Nfkbiz A G 16: 55,821,846 S70P probably damaging Het
Nmi T C 2: 51,950,084 D215G possibly damaging Het
Nphp3 T C 9: 104,018,250 S496P probably damaging Het
Nrp1 T A 8: 128,431,915 C228S probably damaging Het
Olfr787 A T 10: 129,463,521 M282L probably benign Het
Pcdh9 C A 14: 93,886,367 R789L possibly damaging Het
Pigr A T 1: 130,841,766 T105S probably benign Het
Polr2a A C 11: 69,745,977 S383A probably benign Het
Psd3 T A 8: 67,904,166 H634L possibly damaging Het
Ptgr2 T G 12: 84,292,306 probably benign Het
Ptk6 A G 2: 181,198,461 Y251H possibly damaging Het
Rnf213 A G 11: 119,430,468 T1251A Het
Rtkn2 A G 10: 68,041,429 K443E probably damaging Het
Rundc3a T A 11: 102,399,895 L268Q probably damaging Het
Serpinb5 A G 1: 106,875,149 E138G probably benign Het
Shroom1 A T 11: 53,465,248 D375V probably benign Het
Siglecf A G 7: 43,351,817 T70A probably damaging Het
Slc20a2 A T 8: 22,561,400 E483V probably benign Het
Sort1 G A 3: 108,351,680 G676D probably damaging Het
Spef2 T C 15: 9,584,207 S1581G probably benign Het
Stx6 C T 1: 155,197,384 R214* probably null Het
Stxbp5l A G 16: 37,134,341 I950T probably benign Het
Tdrd7 T A 4: 46,013,239 C660S possibly damaging Het
Tgm4 T A 9: 123,056,684 probably null Het
Thap8 C T 7: 30,289,952 L196F unknown Het
Ttc6 A T 12: 57,672,931 probably null Het
Uba2 A G 7: 34,150,814 S405P possibly damaging Het
Usp34 T C 11: 23,432,361 I2043T Het
Vmn1r12 T A 6: 57,159,698 I260N possibly damaging Het
Vmn1r172 C T 7: 23,660,605 T305I unknown Het
Vmn2r24 T C 6: 123,815,679 V655A probably damaging Het
Wdr33 T C 18: 31,886,666 S464P probably benign Het
Zcchc6 A G 13: 59,782,053 I1458T possibly damaging Het
Zfp260 T A 7: 30,105,325 C217S probably damaging Het
Zfp760 A G 17: 21,723,233 E463G probably benign Het
Zhx1 A G 15: 58,053,300 Y517H probably damaging Het
Other mutations in Tmem67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Tmem67 APN 4 12061826 missense probably damaging 0.98
IGL00768:Tmem67 APN 4 12055029 critical splice donor site probably null
IGL00813:Tmem67 APN 4 12058587 splice site probably benign
IGL01070:Tmem67 APN 4 12054750 missense probably benign 0.20
IGL01088:Tmem67 APN 4 12063126 missense probably damaging 1.00
IGL01353:Tmem67 APN 4 12079895 missense probably damaging 1.00
IGL01490:Tmem67 APN 4 12057422 splice site probably benign
IGL01885:Tmem67 APN 4 12057389 missense probably damaging 1.00
IGL02061:Tmem67 APN 4 12053526 missense probably damaging 1.00
IGL02151:Tmem67 APN 4 12068882 missense probably benign 0.35
IGL02166:Tmem67 APN 4 12047313 missense possibly damaging 0.90
IGL02243:Tmem67 APN 4 12070584 missense possibly damaging 0.93
IGL02517:Tmem67 APN 4 12069463 missense possibly damaging 0.67
IGL02736:Tmem67 APN 4 12045789 splice site probably null
R0282:Tmem67 UTSW 4 12087930 missense probably damaging 0.99
R0514:Tmem67 UTSW 4 12089317 missense probably benign
R1221:Tmem67 UTSW 4 12045871 missense possibly damaging 0.92
R1301:Tmem67 UTSW 4 12089400 unclassified probably benign
R1581:Tmem67 UTSW 4 12047814 missense probably damaging 1.00
R1680:Tmem67 UTSW 4 12087840 missense probably benign 0.00
R1804:Tmem67 UTSW 4 12045789 splice site probably null
R2174:Tmem67 UTSW 4 12063730 nonsense probably null
R2191:Tmem67 UTSW 4 12069413 critical splice donor site probably null
R2246:Tmem67 UTSW 4 12040651 missense probably damaging 1.00
R2566:Tmem67 UTSW 4 12079918 missense probably damaging 0.99
R3409:Tmem67 UTSW 4 12073952 missense probably benign 0.00
R3410:Tmem67 UTSW 4 12073952 missense probably benign 0.00
R4078:Tmem67 UTSW 4 12040633 critical splice donor site probably null
R4282:Tmem67 UTSW 4 12073922 missense probably damaging 0.99
R4429:Tmem67 UTSW 4 12051473 missense possibly damaging 0.52
R4430:Tmem67 UTSW 4 12051473 missense possibly damaging 0.52
R4431:Tmem67 UTSW 4 12051473 missense possibly damaging 0.52
R4734:Tmem67 UTSW 4 12063158 missense probably benign 0.00
R4856:Tmem67 UTSW 4 12089416 unclassified probably benign
R4865:Tmem67 UTSW 4 12070262 missense probably benign 0.01
R5056:Tmem67 UTSW 4 12070471 missense probably benign 0.29
R5575:Tmem67 UTSW 4 12047886 missense possibly damaging 0.93
R5614:Tmem67 UTSW 4 12061755 missense possibly damaging 0.54
R6030:Tmem67 UTSW 4 12063799 missense probably benign 0.01
R6030:Tmem67 UTSW 4 12063799 missense probably benign 0.01
R6182:Tmem67 UTSW 4 12051402 missense probably benign 0.05
R6562:Tmem67 UTSW 4 12053445 critical splice donor site probably null
R6574:Tmem67 UTSW 4 12063086 missense possibly damaging 0.70
R6696:Tmem67 UTSW 4 12061754 critical splice donor site probably null
R6824:Tmem67 UTSW 4 12051449 missense probably damaging 1.00
R7028:Tmem67 UTSW 4 12075484 missense probably benign 0.12
R7174:Tmem67 UTSW 4 12077337 missense possibly damaging 0.82
R7638:Tmem67 UTSW 4 12079883 missense probably benign 0.17
R7671:Tmem67 UTSW 4 12063698 missense probably benign 0.00
R7736:Tmem67 UTSW 4 12053455 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GGGGAATGTTAAGGACACTTCC -3'
(R):5'- TTATTGATTGGGAACGGCCG -3'

Sequencing Primer
(F):5'- AAAACTGCTGCGCTGTCTGAG -3'
(R):5'- GAAAGGAAAAGTTCTTAAAGCTGTTG -3'
Posted On2019-09-13