Incidental Mutation 'R7369:Mdn1'
ID571987
Institutional Source Beutler Lab
Gene Symbol Mdn1
Ensembl Gene ENSMUSG00000058006
Gene Namemidasin AAA ATPase 1
Synonyms4833432B22Rik, LOC213784, D4Abb1e
MMRRC Submission
Accession Numbers

Genbank: NM_001081392; MGI: 1926159

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7369 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location32657119-32775217 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32773375 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 5518 (F5518L)
Ref Sequence ENSEMBL: ENSMUSP00000071569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071642] [ENSMUST00000178134]
Predicted Effect probably damaging
Transcript: ENSMUST00000071642
AA Change: F5518L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071569
Gene: ENSMUSG00000058006
AA Change: F5518L

DomainStartEndE-ValueType
low complexity region 48 75 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
Pfam:AAA_5 324 459 7.4e-19 PFAM
AAA 666 908 1.06e-6 SMART
AAA 1072 1217 2.09e-1 SMART
AAA 1378 1544 8.27e-9 SMART
AAA 1740 1893 6.78e-2 SMART
AAA 2053 2309 1.62e0 SMART
low complexity region 3181 3193 N/A INTRINSIC
low complexity region 3541 3552 N/A INTRINSIC
low complexity region 3557 3565 N/A INTRINSIC
low complexity region 4189 4203 N/A INTRINSIC
low complexity region 4339 4353 N/A INTRINSIC
low complexity region 4672 4681 N/A INTRINSIC
low complexity region 4735 4756 N/A INTRINSIC
low complexity region 4769 4790 N/A INTRINSIC
low complexity region 4886 4905 N/A INTRINSIC
low complexity region 4924 4937 N/A INTRINSIC
coiled coil region 4957 4983 N/A INTRINSIC
low complexity region 5000 5017 N/A INTRINSIC
low complexity region 5176 5192 N/A INTRINSIC
low complexity region 5315 5329 N/A INTRINSIC
VWA 5375 5556 2.73e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178134
AA Change: F5511L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136222
Gene: ENSMUSG00000058006
AA Change: F5511L

DomainStartEndE-ValueType
low complexity region 48 75 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
Pfam:AAA_5 324 459 4.4e-19 PFAM
AAA 666 908 1.06e-6 SMART
AAA 1072 1217 2.09e-1 SMART
AAA 1378 1544 8.27e-9 SMART
AAA 1740 1893 6.78e-2 SMART
AAA 2053 2309 1.62e0 SMART
low complexity region 3181 3193 N/A INTRINSIC
low complexity region 3541 3552 N/A INTRINSIC
low complexity region 3557 3565 N/A INTRINSIC
low complexity region 4189 4203 N/A INTRINSIC
low complexity region 4339 4353 N/A INTRINSIC
low complexity region 4667 4676 N/A INTRINSIC
low complexity region 4730 4751 N/A INTRINSIC
low complexity region 4764 4785 N/A INTRINSIC
low complexity region 4881 4900 N/A INTRINSIC
low complexity region 4919 4932 N/A INTRINSIC
coiled coil region 4952 4978 N/A INTRINSIC
low complexity region 4992 5010 N/A INTRINSIC
low complexity region 5169 5185 N/A INTRINSIC
low complexity region 5308 5322 N/A INTRINSIC
VWA 5368 5549 2.73e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (77/77)
Allele List at MGI

All alleles(29) : Targeted, other(2) Gene trapped(27)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T A 6: 129,331,533 Q11L possibly damaging Het
A930017K11Rik G A 17: 25,947,960 S201L probably damaging Het
Ahr A T 12: 35,504,660 W487R possibly damaging Het
Apaf1 A G 10: 91,001,036 S1060P probably damaging Het
Atf7 G T 15: 102,553,809 P126H probably damaging Het
B3gnt5 C A 16: 19,769,660 Q210K probably benign Het
Begain T C 12: 109,033,927 Y306C possibly damaging Het
Car5a T C 8: 121,923,834 K157R probably benign Het
Car5b A C X: 164,014,840 S35R probably benign Het
Cdh6 A G 15: 13,042,638 V478A probably damaging Het
Cdyl A G 13: 35,816,009 E91G probably damaging Het
Cep135 A C 5: 76,593,253 K59Q possibly damaging Het
Cnot3 T A 7: 3,653,331 D205E possibly damaging Het
Dgkd G A 1: 87,921,622 G379R probably damaging Het
Dppa1 T A 11: 46,616,117 probably null Het
Dsp G T 13: 38,197,525 V2749F possibly damaging Het
E2f4 A G 8: 105,300,334 K177E probably benign Het
Efcab5 G A 11: 77,117,835 P819L possibly damaging Het
Ercc5 T A 1: 44,180,860 S1097R probably benign Het
Erp44 T C 4: 48,218,183 N162S probably benign Het
Evl A G 12: 108,686,565 Y423C unknown Het
Fam78a T A 2: 32,069,687 N137I probably damaging Het
Fcrla T G 1: 170,922,317 D57A probably benign Het
Fcrls T C 3: 87,256,701 N374D possibly damaging Het
Gm7145 A T 1: 117,986,108 H240L probably benign Het
Kdm5a T A 6: 120,432,004 N1549K possibly damaging Het
Kirrel C T 3: 87,141,084 R9H probably benign Het
Klf7 T C 1: 64,121,141 probably null Het
Lce1d G A 3: 92,686,083 Q8* probably null Het
Lcn4 T C 2: 26,667,894 H180R probably benign Het
Lmntd1 T A 6: 145,413,575 Y283F probably damaging Het
Lrp1b C T 2: 41,282,039 R1646K Het
Map3k21 C A 8: 125,911,116 A147E possibly damaging Het
Mapk8ip2 T C 15: 89,454,251 S11P probably benign Het
Mfsd7a A G 5: 108,445,528 V148A probably benign Het
Msh3 T A 13: 92,299,262 T510S probably benign Het
Myh1 A T 11: 67,220,698 Q1654H probably damaging Het
Ncbp3 T C 11: 73,077,921 V506A probably benign Het
Nfkbiz A G 16: 55,821,846 S70P probably damaging Het
Nmi T C 2: 51,950,084 D215G possibly damaging Het
Nphp3 T C 9: 104,018,250 S496P probably damaging Het
Nrp1 T A 8: 128,431,915 C228S probably damaging Het
Olfr787 A T 10: 129,463,521 M282L probably benign Het
Pcdh9 C A 14: 93,886,367 R789L possibly damaging Het
Pigr A T 1: 130,841,766 T105S probably benign Het
Polr2a A C 11: 69,745,977 S383A probably benign Het
Psd3 T A 8: 67,904,166 H634L possibly damaging Het
Ptgr2 T G 12: 84,292,306 probably benign Het
Ptk6 A G 2: 181,198,461 Y251H possibly damaging Het
Rnf213 A G 11: 119,430,468 T1251A Het
Rtkn2 A G 10: 68,041,429 K443E probably damaging Het
Rundc3a T A 11: 102,399,895 L268Q probably damaging Het
Serpinb5 A G 1: 106,875,149 E138G probably benign Het
Shroom1 A T 11: 53,465,248 D375V probably benign Het
Siglecf A G 7: 43,351,817 T70A probably damaging Het
Slc20a2 A T 8: 22,561,400 E483V probably benign Het
Sort1 G A 3: 108,351,680 G676D probably damaging Het
Spef2 T C 15: 9,584,207 S1581G probably benign Het
Stx6 C T 1: 155,197,384 R214* probably null Het
Stxbp5l A G 16: 37,134,341 I950T probably benign Het
Tdrd7 T A 4: 46,013,239 C660S possibly damaging Het
Tgm4 T A 9: 123,056,684 probably null Het
Thap8 C T 7: 30,289,952 L196F unknown Het
Tmem67 T C 4: 12,053,535 Y671C probably damaging Het
Ttc6 A T 12: 57,672,931 probably null Het
Uba2 A G 7: 34,150,814 S405P possibly damaging Het
Usp34 T C 11: 23,432,361 I2043T Het
Vmn1r12 T A 6: 57,159,698 I260N possibly damaging Het
Vmn1r172 C T 7: 23,660,605 T305I unknown Het
Vmn2r24 T C 6: 123,815,679 V655A probably damaging Het
Wdr33 T C 18: 31,886,666 S464P probably benign Het
Zcchc6 A G 13: 59,782,053 I1458T possibly damaging Het
Zfp260 T A 7: 30,105,325 C217S probably damaging Het
Zfp760 A G 17: 21,723,233 E463G probably benign Het
Zhx1 A G 15: 58,053,300 Y517H probably damaging Het
Other mutations in Mdn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Mdn1 APN 4 32723651 missense probably damaging 1.00
IGL00426:Mdn1 APN 4 32719214 missense possibly damaging 0.91
IGL00570:Mdn1 APN 4 32735719 missense probably benign
IGL00573:Mdn1 APN 4 32666619 critical splice donor site probably null
IGL00983:Mdn1 APN 4 32735525 missense probably damaging 1.00
IGL01288:Mdn1 APN 4 32730864 missense probably benign 0.00
IGL01359:Mdn1 APN 4 32743686 missense probably benign 0.10
IGL01457:Mdn1 APN 4 32715922 missense possibly damaging 0.82
IGL01530:Mdn1 APN 4 32711938 splice site probably benign
IGL01684:Mdn1 APN 4 32726857 missense probably benign
IGL01753:Mdn1 APN 4 32708483 missense probably benign
IGL01901:Mdn1 APN 4 32669591 missense probably damaging 1.00
IGL01952:Mdn1 APN 4 32723657 missense possibly damaging 0.82
IGL01960:Mdn1 APN 4 32758393 missense probably benign 0.14
IGL02019:Mdn1 APN 4 32749948 missense possibly damaging 0.93
IGL02100:Mdn1 APN 4 32715708 missense possibly damaging 0.90
IGL02117:Mdn1 APN 4 32709364 missense probably benign 0.00
IGL02154:Mdn1 APN 4 32740395 missense probably benign 0.35
IGL02216:Mdn1 APN 4 32739092 missense probably benign 0.03
IGL02371:Mdn1 APN 4 32676860 splice site probably benign
IGL02396:Mdn1 APN 4 32700120 missense probably damaging 0.99
IGL02454:Mdn1 APN 4 32694674 critical splice donor site probably null
IGL02502:Mdn1 APN 4 32670579 missense possibly damaging 0.69
IGL02883:Mdn1 APN 4 32763199 missense probably benign 0.05
IGL02946:Mdn1 APN 4 32734366 missense probably damaging 0.98
IGL02950:Mdn1 APN 4 32713360 splice site probably benign
IGL03076:Mdn1 APN 4 32735564 missense probably damaging 0.97
IGL03129:Mdn1 APN 4 32729994 missense possibly damaging 0.47
IGL03234:Mdn1 APN 4 32732842 missense probably benign 0.06
3-1:Mdn1 UTSW 4 32725967 critical splice donor site probably null
IGL03046:Mdn1 UTSW 4 32694495 missense possibly damaging 0.73
P0035:Mdn1 UTSW 4 32749934 missense probably benign 0.05
PIT4508001:Mdn1 UTSW 4 32719223 missense probably damaging 0.97
PIT4618001:Mdn1 UTSW 4 32746527 missense probably benign 0.20
R0008:Mdn1 UTSW 4 32718317 missense possibly damaging 0.47
R0110:Mdn1 UTSW 4 32738619 missense probably benign 0.20
R0125:Mdn1 UTSW 4 32729956 missense probably damaging 0.98
R0257:Mdn1 UTSW 4 32693534 missense probably damaging 0.99
R0266:Mdn1 UTSW 4 32741835 missense probably damaging 0.99
R0349:Mdn1 UTSW 4 32750318 missense probably damaging 1.00
R0362:Mdn1 UTSW 4 32746439 critical splice acceptor site probably null
R0421:Mdn1 UTSW 4 32684707 missense probably benign 0.39
R0450:Mdn1 UTSW 4 32738619 missense probably benign 0.20
R0465:Mdn1 UTSW 4 32699204 splice site probably benign
R0469:Mdn1 UTSW 4 32738619 missense probably benign 0.20
R0477:Mdn1 UTSW 4 32750928 missense probably benign 0.02
R0481:Mdn1 UTSW 4 32767182 splice site probably benign
R0504:Mdn1 UTSW 4 32698916 splice site probably benign
R0522:Mdn1 UTSW 4 32672837 missense probably benign 0.09
R0550:Mdn1 UTSW 4 32730479 missense probably benign 0.13
R0607:Mdn1 UTSW 4 32712014 missense probably damaging 1.00
R0607:Mdn1 UTSW 4 32732829 missense probably benign 0.36
R0664:Mdn1 UTSW 4 32768011 nonsense probably null
R0701:Mdn1 UTSW 4 32699263 missense probably benign 0.00
R0801:Mdn1 UTSW 4 32668895 missense probably benign 0.04
R0841:Mdn1 UTSW 4 32752032 missense probably benign 0.23
R0849:Mdn1 UTSW 4 32741835 missense probably damaging 0.99
R0893:Mdn1 UTSW 4 32701713 missense probably benign 0.01
R1114:Mdn1 UTSW 4 32746568 critical splice donor site probably null
R1137:Mdn1 UTSW 4 32694511 missense probably damaging 1.00
R1185:Mdn1 UTSW 4 32735576 missense possibly damaging 0.94
R1185:Mdn1 UTSW 4 32735576 missense possibly damaging 0.94
R1185:Mdn1 UTSW 4 32735576 missense possibly damaging 0.94
R1257:Mdn1 UTSW 4 32667089 critical splice acceptor site probably null
R1356:Mdn1 UTSW 4 32700334 splice site probably benign
R1466:Mdn1 UTSW 4 32730788 missense probably benign 0.28
R1466:Mdn1 UTSW 4 32730788 missense probably benign 0.28
R1518:Mdn1 UTSW 4 32739977 missense probably damaging 1.00
R1569:Mdn1 UTSW 4 32723501 missense probably null 0.10
R1574:Mdn1 UTSW 4 32722315 missense probably benign
R1574:Mdn1 UTSW 4 32722315 missense probably benign
R1591:Mdn1 UTSW 4 32700092 missense possibly damaging 0.65
R1678:Mdn1 UTSW 4 32663050 missense probably damaging 0.99
R1696:Mdn1 UTSW 4 32700417 missense possibly damaging 0.91
R1707:Mdn1 UTSW 4 32693504 missense probably damaging 1.00
R1749:Mdn1 UTSW 4 32773952 missense probably damaging 1.00
R1780:Mdn1 UTSW 4 32700103 missense probably damaging 1.00
R1833:Mdn1 UTSW 4 32720761 missense probably damaging 0.97
R1858:Mdn1 UTSW 4 32730881 missense probably benign 0.17
R1870:Mdn1 UTSW 4 32763339 missense probably damaging 1.00
R1887:Mdn1 UTSW 4 32742540 missense probably damaging 1.00
R1909:Mdn1 UTSW 4 32760839 small deletion probably benign
R2075:Mdn1 UTSW 4 32716058 missense probably benign 0.03
R2103:Mdn1 UTSW 4 32738712 missense possibly damaging 0.75
R2104:Mdn1 UTSW 4 32743843 splice site probably null
R2110:Mdn1 UTSW 4 32700409 missense probably damaging 1.00
R2111:Mdn1 UTSW 4 32700409 missense probably damaging 1.00
R2206:Mdn1 UTSW 4 32716271 missense possibly damaging 0.71
R2221:Mdn1 UTSW 4 32763306 missense probably benign 0.37
R2240:Mdn1 UTSW 4 32765701 missense possibly damaging 0.90
R2351:Mdn1 UTSW 4 32750010 missense probably benign 0.21
R2421:Mdn1 UTSW 4 32723621 missense probably damaging 0.96
R3036:Mdn1 UTSW 4 32750013 missense probably damaging 0.99
R3434:Mdn1 UTSW 4 32733726 critical splice donor site probably null
R3435:Mdn1 UTSW 4 32733726 critical splice donor site probably null
R3783:Mdn1 UTSW 4 32720818 missense probably benign 0.01
R3811:Mdn1 UTSW 4 32693506 nonsense probably null
R3973:Mdn1 UTSW 4 32722363 missense probably benign 0.00
R4154:Mdn1 UTSW 4 32707475 missense probably damaging 0.96
R4372:Mdn1 UTSW 4 32743809 missense probably benign 0.03
R4393:Mdn1 UTSW 4 32754482 missense possibly damaging 0.48
R4438:Mdn1 UTSW 4 32704635 missense probably damaging 1.00
R4471:Mdn1 UTSW 4 32668860 missense probably benign 0.00
R4509:Mdn1 UTSW 4 32715883 missense probably damaging 1.00
R4538:Mdn1 UTSW 4 32722334 missense probably damaging 1.00
R4557:Mdn1 UTSW 4 32754437 missense probably damaging 1.00
R4570:Mdn1 UTSW 4 32741812 missense probably damaging 1.00
R4591:Mdn1 UTSW 4 32707636 missense probably damaging 1.00
R4658:Mdn1 UTSW 4 32730749 splice site probably null
R4667:Mdn1 UTSW 4 32679572 missense probably damaging 1.00
R4684:Mdn1 UTSW 4 32666430 missense probably damaging 1.00
R4778:Mdn1 UTSW 4 32683583 nonsense probably null
R4807:Mdn1 UTSW 4 32685651 splice site probably null
R4923:Mdn1 UTSW 4 32671608 missense possibly damaging 0.89
R4951:Mdn1 UTSW 4 32707459 missense probably damaging 1.00
R4963:Mdn1 UTSW 4 32756512 missense probably benign 0.00
R4971:Mdn1 UTSW 4 32739827 missense probably damaging 1.00
R4973:Mdn1 UTSW 4 32734418 missense probably benign 0.01
R5122:Mdn1 UTSW 4 32670593 missense probably damaging 1.00
R5159:Mdn1 UTSW 4 32774008 missense possibly damaging 0.93
R5164:Mdn1 UTSW 4 32759011 intron probably null
R5215:Mdn1 UTSW 4 32741418 missense possibly damaging 0.78
R5217:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5219:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5365:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5366:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5368:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5445:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5462:Mdn1 UTSW 4 32720897 missense probably benign
R5522:Mdn1 UTSW 4 32685783 missense probably damaging 1.00
R5525:Mdn1 UTSW 4 32767961 missense possibly damaging 0.73
R5578:Mdn1 UTSW 4 32728167 missense probably benign 0.04
R5605:Mdn1 UTSW 4 32765664 missense probably benign
R5621:Mdn1 UTSW 4 32716371 missense possibly damaging 0.46
R5636:Mdn1 UTSW 4 32695480 missense probably damaging 1.00
R5650:Mdn1 UTSW 4 32667467 splice site probably null
R5780:Mdn1 UTSW 4 32722950 missense probably benign 0.02
R5838:Mdn1 UTSW 4 32754547 missense probably damaging 0.99
R5857:Mdn1 UTSW 4 32670646 missense probably benign 0.09
R5895:Mdn1 UTSW 4 32695400 missense probably damaging 1.00
R5943:Mdn1 UTSW 4 32678330 missense probably damaging 1.00
R6008:Mdn1 UTSW 4 32741073 missense probably damaging 1.00
R6013:Mdn1 UTSW 4 32715713 missense probably damaging 1.00
R6075:Mdn1 UTSW 4 32689581 missense possibly damaging 0.48
R6151:Mdn1 UTSW 4 32684735 missense probably damaging 1.00
R6163:Mdn1 UTSW 4 32716040 missense probably damaging 1.00
R6181:Mdn1 UTSW 4 32715953 missense probably damaging 1.00
R6211:Mdn1 UTSW 4 32696269 missense probably benign 0.12
R6249:Mdn1 UTSW 4 32708484 missense possibly damaging 0.85
R6251:Mdn1 UTSW 4 32748590 missense probably benign 0.13
R6253:Mdn1 UTSW 4 32749593 missense probably benign 0.25
R6273:Mdn1 UTSW 4 32715979 missense probably benign 0.01
R6297:Mdn1 UTSW 4 32730054 nonsense probably null
R6384:Mdn1 UTSW 4 32670607 missense probably damaging 1.00
R6463:Mdn1 UTSW 4 32773308 missense probably damaging 1.00
R6528:Mdn1 UTSW 4 32713780 missense probably damaging 1.00
R6688:Mdn1 UTSW 4 32774041 missense possibly damaging 0.74
R6762:Mdn1 UTSW 4 32676786 missense possibly damaging 0.50
R6794:Mdn1 UTSW 4 32741893 missense probably damaging 1.00
R6894:Mdn1 UTSW 4 32748614 missense possibly damaging 0.75
R6935:Mdn1 UTSW 4 32774041 missense possibly damaging 0.74
R6980:Mdn1 UTSW 4 32726942 critical splice donor site probably null
R6995:Mdn1 UTSW 4 32733374 missense probably benign 0.03
R7048:Mdn1 UTSW 4 32767969 missense probably benign 0.00
R7082:Mdn1 UTSW 4 32762341 missense probably benign
R7158:Mdn1 UTSW 4 32725121 missense probably benign 0.09
R7166:Mdn1 UTSW 4 32746446 missense probably damaging 1.00
R7168:Mdn1 UTSW 4 32719184 missense probably damaging 1.00
R7175:Mdn1 UTSW 4 32694634 missense probably damaging 1.00
R7195:Mdn1 UTSW 4 32701823 missense probably damaging 1.00
R7250:Mdn1 UTSW 4 32695427 missense probably damaging 1.00
R7274:Mdn1 UTSW 4 32725944 missense probably benign 0.12
R7330:Mdn1 UTSW 4 32723685 missense probably benign 0.16
R7363:Mdn1 UTSW 4 32691729 missense probably damaging 0.99
R7452:Mdn1 UTSW 4 32739030 missense possibly damaging 0.87
R7523:Mdn1 UTSW 4 32667270 critical splice acceptor site probably null
R7594:Mdn1 UTSW 4 32696359 missense probably benign 0.27
R7605:Mdn1 UTSW 4 32694599 missense probably damaging 1.00
R7661:Mdn1 UTSW 4 32691229 missense probably benign 0.08
R7689:Mdn1 UTSW 4 32739912 missense probably damaging 1.00
R7699:Mdn1 UTSW 4 32741344 missense probably damaging 1.00
R7700:Mdn1 UTSW 4 32741344 missense probably damaging 1.00
R7714:Mdn1 UTSW 4 32722360 missense possibly damaging 0.75
R7718:Mdn1 UTSW 4 32718420 missense probably damaging 1.00
R7762:Mdn1 UTSW 4 32734421 missense probably benign
R7787:Mdn1 UTSW 4 32741794 missense probably damaging 1.00
R8111:Mdn1 UTSW 4 32674003 missense possibly damaging 0.81
X0066:Mdn1 UTSW 4 32739030 missense probably damaging 1.00
Z1176:Mdn1 UTSW 4 32667102 missense probably benign 0.01
Z1176:Mdn1 UTSW 4 32668944 missense probably damaging 1.00
Z1176:Mdn1 UTSW 4 32696244 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCAAAGTGTCAGCTCC -3'
(R):5'- GTCTTCACCTTGCAGGGTTG -3'

Sequencing Primer
(F):5'- TCTTTAGAATGCCCACAGGTG -3'
(R):5'- CACCTTGCAGGGTTGTGTGG -3'
Posted On2019-09-13